help to solve question 1 to 4 ( all please) 1. Below is a gene on DNA in a prokaryotic cell. Draw the mRNA molecule thatwould be made from this gene. Include the appropriate RNA nucleotides tomatch those of the DNA.chromosomogeneTG G GT A A+gene2. List the string of amino acids found in the polypeptide that would be madefrom the above mRNA molecule. Remember to look for the "start" codon andthe "stop" codon. Use Figure 17.5 in your text (or handout).3. A point mutation caused a change in a single nucleotide in the above gene.The adenine with the asterisk (A*) was replaced with a cytosine. Now drawthe string of amino acids coded for by the mutatedgene.4. What is the specific name for this type of mutation?

It can exist in various forms like primary, secondary and tertiary based on its level of…

1. Below is a gene on DNA in a prokaryotic cell. Draw the mRNA molecule that would be made from this gene. Include the appropriate RNA nucleotides to match those of the DNA. chromosome * CA TA cG CA A Á YGGGTA ACCATTA AC gene - 5' +gene

1. Below is a gene on DNA in a prokaryotic cell. Draw the mRNA molecule that would be made from this gene. Include the appropriate RNA nucleotides to match those of the DNA. chromosome * CA TA cG CA A Á YGGGTA ACCATTA AC gene - 5' +gene

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter15: From Dna To Protein

Section: Chapter Questions

Problem 5TYK: Which of the following statements is false? a. GTP is an energy source during various stages of...

See similar textbooks

Related questions

Q: transcribed RNA

A: Transcription is the process of copying a segment of DNA into RNA. Only one of the two DNA strands…

Q: GS 42 CI G4 AUG AUG CUC CUC ACG GAC Uuc UAC CGG R (the strand Y CUC GAG AAG The circled structure…

A: The process shown in the image is Translation where with the help of ribosome and tRNA from the mRNA…

Q: In a bacterial cell, the DNA is in the _______. a) nucleoid b) cell envelope c) cell membrane d)…

A: Introduction: Bacteria, like other species, rely on double-stranded DNA for genetic material.…

Q: During transcription, 1 nucleotide of DNA corresponds with ________ nucleotide of RNA:

A: Answer: Transcription : It is the process in central dogma during which DNA is transcribed in to…

Q: It is a permanent change in the DNA sequence that makes up a gene. Mutations range in size from one…

A: Mutation is any certain change in chromosome or gene of a species and this change can transfer from…

Q: The template strand of DNA is 3’AGGATGCACGTAC5’ The sequence of the mRNA that is made from this DNA…

A: The RNA sequence would be same as coding strand (except thiamine is replaced by uracil) and opposite…

Q: 1. Draw a schematic of a stretch of DNA (horizontally) in the space below to represent a gene a. Put…

A: DNA deoxyribonucleic acid is a genetic material in many organisms this genetic material inherited to…

Q: onsense mutations occur when: A.The new codon causes an incorrect amino acid to code for an…

A: A mutation is a mistake within the deoxyribonucleic acid sequence of an associate organism.…

Q: 1. Write the complementary coding strand sequence 5' GGG ATG TCA CAC ATA TTT 2. Write the mRNA…

A: The coding strand of DNA is the one that contains the instructions for the gene in concern. The…

Q: 2. Refer to the protein phe-trp-tyr-cys-ala-met-leu, construct a DNA strand that can transcript an…

A: mRNA stands for messenger RNA which is a single stranded RNA molecule that is complementary to one…

Q: After being exposed to radioactive, a strand of DNA with the sequence ATTATCTGC has been changed to…

A: Mutations are nothing but change in the nucleotide sequence in the genetic material . It is of…

Q: 11. The template DNA for the beginning a gene is 3' – GATACATGAGGCGATACG – 5'. What mRNA transcript…

A: DNA and RNA are are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid…

Q: A nucleotide sequence in a segment of a DNA information strand is given here. Sketch (A) the…

Q: 13 The image shows a normal chromosome and a mutated chromosome with the gene for hair type labeled.…

A: Mutation refers to sudden heritable change in the phenotype of an individual. In the molecular term,…

Q: Most segmentation genes code for (a) transfer RNAs (b) enzymes (c) transcription factors (d)…

A: Transcription factors

Q: nclude the ideas of transcription and translation. Compare the normal and abnormal strands to see…

A: Transcription : It is the process of making an RNA copy of a gene sequence . This copy is called…

Q: THE FAT CAT SAT" is the original strand, if it turns to " THE EFA TCA TSA T" what type of mutation?…

A: *NOTE: Kindly repost for other questions. Dear Student as per the guidelines we are supposed to…

Q: Depict the RNA transcript in the box below 5' - ATG GGG CCC GTT TTC AAT ATG CAG GTC CAT CCG TAC GTA…

A: DNA undergoes the process of transcription to copy itself into RNA. The segments of RNA that can be…

Q: 1. Which describe/s gene mutation? I. Deletes a segment of a chromosome 2 points without a…

A: D. I,II,III

Q: "Knocking out" a gene with CRISPR-Cas9 leads to which of the following? O disruption of a gene O…

A: CRISPR-Cas9 is a unique technology that helps geneticists and researchers to edit a particular part…

Q: 1. Of which of these do your cells have the least of? A. MRNA B. FRNA C. TRNA D. NDNA E. Proteins 2.…

A: Cells are composed of different components, cell organelles and molecules that are responsible for…

Q: 1. Arrange the following structures from largest to smallest. • a chromosome • a nucleus • a gene…

A: The nucleus is an organelle found in eukaryotic cells. Inside its fully enclosed nuclear membrane,…

Q: 7. The beoads on a string in the picture represent what in terms OE DRA 20lding? "Beads on a string"…

A: Template strand is also known as sense strand. This is actively involved in transcription. The…

Q: For each species, all______ in the complete set of chromosomes is the____ . a. genomes; library c.…

A: Chromosomes are the thread-like structures that appear during cell division.

Q: Below is a DNA template strand for RNA transcription where the * and “ mark the beginning and end of…

A: Transcription is the process by which the information in a DNA strand (template) is copied into a…

Q: 5' - ATG GGG CCC GTT TTC AAT ATG CAG GTC CAT CCG TAC GTA CAG GCC GGA ATT TGA - 3' There are two…

A: Introns are the intervening or noncoding sequence present between the coding sequence.

Q: Fill in the blanks: DNA fragment A is 3' AGC CCG CTC CGA GGC TAA AAG CGT 5' is % of guanine in DNA…

Q: The function of mRNA is to (a) deliver amino acids to the ribosome (b) act as the…

A: The DNA (deoxyribonucleic acid) is the genetic material of an organism. The DNA is inherited by the…

Q: 7. Complete the following diagram which describes a small eukaryotic open reading frame by filling…

A: DNA (Deoxyribonucleic acid) and RNA are two examples of nucleic acids (Ribonucleic acid).…

Q: Match the terms with the best description.____ genetic message a. protein-coding…

A: A gene is a specific sequence of nucleotides in DNA or RNA that is usually found on a chromosome and…

Q: 3) The semiconservative model of DNA implies: " O The nuclear envelope is semipermeable O Half of…

A: Half of the parental DNA is conserved in the next generation in this semiconservative model. For…

Q: Fill in the blanks. In this schematic, [] represents a gene (DNA) that is transcribed and processed…

A: Transcription is a significant process that occurs in a cell through which the RNA is synthesized…

Q: 2. What will most likely happen if there is a change in the base sequence of this molecule? a. The…

A: During DNA replication, mutations can occur if mistakes are made and not corrected in time.…

Q: he diagram below represents a segment of a gene on two chromosomes. Normal gene A A Mutated gene A T…

A: Mutation is a heritable genetic change in the genetic material of the organisms which results in…

Q: What are exons? Amino acid sequences that code for a functional protein O Sites where repressor…

Q: 2a. The DNA is mutated on the 4th base pair to the following: DNA:3'TAC GAT GAG GTC TGA ACT 5' 5 ATG…

A: Mutations are changes in the base pair that can effect the way proteins and mRNA is formed it can…

Q: 1. The number of copies of a gene is called Group of answer choices a. Ploidy b. Gene Dosage c.…

A: Given: Need to answer the given questions related to biology

Q: the mutations

Q: ? 1. mRNA is formed with codons as product ons are translated and polypeptide chain is tr es into…

A: Genetic material- DNA and RNA acts as the genetic material in most of the organisms . DNA stands…

Q: 1. Transcription: Write out the sequence of mRNA that would result from transcription of the…

A: The gene is expressed from DNA into protein by Central Dogma. The transcription and translation…

Q: DNA fragment A is 3' AGC CCG CTC CGA GGC TAA AAG CGT 5' is % of guanine in DNA fragment A is the 4th…

A: As per our company guidelines, we are supposed to answer only first 3 sub-parts. Kindly repost the…

Q: 7. Complete the following diagram which describes a small eukaryotic open reading frame, by filling…

A: Genes are the fundamental unit of heredity. They store genetic information in the form of DNA, which…

Q: Match the terms appropriately.___ bacteriophage a. nitrogen-containing base,___ clone…

A: Nucleic acid is the polymer of nucleotides. There are two types of nitrogenous bases in DNA: purines…

Q: Translate a mRNA sequence into a protein sequence using the genetic code. 2) write the…

Q: At the DNA level, a mutation in a protein coding region where a single base is replaced by another…

A: Mutation is the abrupt change that occurs in the sequence of DNA resulting In altered phenotype.…

Q: On Figure , indicate the locations of the promoters and terminators for genes a, b, and c.

A: Gene is the structural and functional unit in the DNA. Genes are composed of nucleotide nitrogenous…

Q: 1. Transcription: Write out the sequence of mRNA that would result from transcription of the…

A: The central dogma The central dogma is the process involving three major events in cells these are…

Q: During translation, __________________. a. A cell divides to make 2 new cells b. A cell divides to…

A: Cell is the basic structural and functional unit of life.

Q: A mutation is a change that occurs in our DNA sequence, either due to mistakes when the DNA is…

A: Option D is the right answer. Mutations occur due to the exposure of certain ionising radiations,…

Concept explainers

Learning and memory

Learning is defined as a relatively permanent and irreversible adaptive change in behavior. It always results from experience. The ability of an organism to store and recall the effects, sensations, and knowledge gained through learning and experience is called memory.

Question

help to solve question 1 to 4 ( all please)

1. Below is a gene on DNA in a prokaryotic cell. Draw the mRNA molecule that
would be made from this gene. Include the appropriate RNA nucleotides to
match those of the DNA.
chromosomo
gene
TG G GT A A
+gene
2. List the string of amino acids found in the polypeptide that would be made
from the above mRNA molecule. Remember to look for the "start" codon and
the "stop" codon. Use Figure 17.5 in your text (or handout).
3. A point mutation caused a change in a single nucleotide in the above gene.
The adenine with the asterisk (A*) was replaced with a cytosine. Now draw
the string of amino acids coded for by the mutated
gene.
4. What is the specific name for this type of mutation?

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1 DNA (deoxyribonucleic acid) is the hereditary material present in most living organisms.

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

A chromosome contains many different genes that are transcribed into different ___ . a. proteins b. polypeptides c. RNAs d. a and b
Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
A part of an mRNA molecule with the sequence 5-UGC GCA-3 is being translated by a ribosome. The following activated tRNA molecules are available. tRNA Anticodon Amino Acid 3-GGC-5 Proline 3-CGU-5 Alanine 3-UGC-5 Treonine 3-CCG-5 Glycine 3-ACG-5 Cysteine 3-CGC-5 Alanine Which two of them can bind correctly to the mRNA so that a dipeptide can form? a. cysteinealanine b. prolinecysteine c. glycinecysteine d. alaninealanine e. threonineglycine
Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?
Which of the following statements is false? a. GTP is an energy source during various stages of translation. b. In the ribosome, peptidyl transferase catalyzes peptide bondformation between amino acids. c. When the mRNA code UAA reaches the ribosome, there isno tRNA to bind to it. d. A long polypeptide is cut off the tRNA in the A site so its Metamino acid links to the amino acid in the P site. e. Forty-two amino acids of a protein are encoded by 126nucleotides of the mRNA.
Mechanisms that govern gene expression do not operate during ___ . a. transcription b. RNA processing c. translation d. knockouts
8. For the double strand DNA molecule below, assume the 3' DNA strand acts as the template for creating the MRNA. Write the corresponding MRNA 5' 1 3' and translate this mRNA into protein. DNA 3' CGTGAATACGCTACGGAACTCACTGGTA 5' DNA 5' GGCACTTATGCGATGCCTTGAGTGACCAT 3' MRNA 5' Protein UCAGUCAG UCPG Alanine GU U/c GU A Tyrosine C Stop A G Cysteine Valine G A Stop G Tryptophan Arginine A G AC A C UG ACUGACU C Leucine Serine G C A Lysine Proline Asparagine Glycine alanine Leucine Phenyl- Serine Glutamic acid Aspartic acid Histidine Glutamine Threonine
6. Similar to the class notes (Intro to Genetics), a segment of DNA (shown below) contains a promoter segment (the first 9 base pairs), a ribosome binding segment (the next 6 base pairs), and a segment that codes for protein synthesis which is started by the rest of the base pairs. ACTCCATTGAACCATTTCTATGATCCGCTAACG-... TGAGGTAACTTGGTAAAGATACTAGGCGATTGC-... A. When the DNA is induced to be copied to mRNA, the top strand is coding, meaning that the mRNA makes an identical copy of the lower strand (replacing T with U) The mRNA copy starts with the ribosome binding sequence. What is the sequence of the mRNA that will go to the ribosomes? B. What are the first 6 amino acids of the protein that are coded for by the mRNA? C. What would the amino acid sequence be if... i. a transition mutation occurred on the final G in the mRNA? ii. all of the G & C bases in the protein synthesis portion had transition mutations? iii. a point deletion mutation occurred in the ATA sequence (in the lower strand…
D. The sequence of a eukaryotic gene is given below, where in boed an inset containing: 5'GA TTATGGAATTCACCTAT GATCGCAT GGCCATTGAACCT 3 3CTAATACETTAAGTGGATA CTAGCGTA CCGGTAACIT GGA 5 A. Write the sequence of the WRNA produced by its process of transcription and of wRNA that is transferred to ribosomes in order to produce the peptide B. A mutation has occured in the above gene. The GIC pair highlighted replaced by T/A. Cells that are homozygous for that mutation become Cancerous. Do think this gene is a you proto-oncogene? or a tumor suppressor gene and why? describes D₂. The following family tree is given which the way inheritance of a dease. It is noted that only one of its two persons generation I is heterozygous and that one of the individuals in subsequent generations exhibits unexpected Phenotype. Individuals II4 and III2 show its phenotype disease. The remaining individuals have normal phenotype. α
5’ AUG UUA CGU AAU GCU GUC GAA UCU AUU UGC UUU ACA UAA 3' Write the sequence of the DNA template (antisense) strand from which the mRNA was synthesized. Write the sequence of the DNA coding (sense or informational) strand complementary to the template strand. Write the sequence of tRNA anticodon that corresponds to the given mRNA molecule. Write the amino acid sequence of the peptide synthesized from the given mRNA nucleotide sequence.
11. Draw the tRNAs on top of the following mRNA template. Make sure to include the anticodon and correct amino acid on each tRNA 5-A UGCC GUACCAGGAG-3¹
6. How many amino acids will the mRNA sequence "AUG GAC CUG UCG UGA" produce? (LS1-1) * Second MRNA base C. UUU Phe UUC UCU UAU UGU Cps UGC U Tyr UAC UCC Ser UCA UUA Leu UUG UAA Stop UGA Stop A Gu (G) 19) UCG UAG Stop UGG Trp G. Tye AGU A CUU CCU CAU His CAC CGU CUC Leu CUA CC CGC Cys (C) Pro CAA Gin CAG Arg CGA CCA CUG. CCG CGG Arg R AU ACU A C AAU Asn AAC Thr Le AGU Ser AGC AUC e ACC C AUA ACA Lys IK AGA Lys AGG AAA AUG M ACG AAG The GUU GCU GAU GGU Asa GAC GCC Val GCA GGC Ala Gly GUA GAA GGA Glu GSG GUG GCG GAG First mRNA base (5' end of codon) Third mRNA base (3' end of codon)