1. Complete the following table based on your lac operon simulations. Absence of lactose Presence of lactose B-galactosidase permease B-galactosidase permease I'P*O*Z*Y* I'P*0Z*Y* - Mututed ISP+O*ZY* I'P*OʻZ*Y* I*P*O°ZY
Q: Predict a possible phenotype from the following mutations in the Lac Operon: a deletion in…
A: Lac operon was discovered by Jacob and Monod in Escherichia coli. They found that this bacteria…
Q: 1) The logic of the Lac operon was deciphered by using bacterial lac-operon mutants. Crucial to the…
A: Lac operon is a genetic unit in bacteria that helps in the metabolism of lactose in E.coli and lac…
Q: The diagram below represents a hypothetical operon in the bacterium E. coli. The operon consists of…
A: Operon Operon is a place within the DNA which have several gene and all these genes are controlled…
Q: The lac operon regulates expression of genes required for the breakdown of lactose. Use the…
A: The correct answers are 1- RNA polymerase can bind tightly to the lac Z promoter and activate a high…
Q: 1. IPTG can be used in the laboratory as a synthetic inducer of the lac operon, instead of lactose.…
A: In the lac operon, the partial diploids are produced by conjugation between F' x F, it will have…
Q: The genes shown are from the lac operon system of E.coli. The symbols a, b and c represent the…
A:
Q: For the given genotypes (associated with the lac operon in E. coli), indicate with a "+" or "-"…
A: The lactose operon is an example of inducible operon in which the presence of lactose is responsible…
Q: 4a. The diagram below represents (a) the lac operon in the OFF state and (b) lac operon in the ON…
A: Note - Since you have asked multiple questions, we will solve the first question for you. If you…
Q: The lac genotypes are as shown below: P+OcZ-Y+A+// P¯O+Z+Y+A+ (i) The lac operon consists of three…
A: Introduction The lactose operon (also known as the lac operon) is a group of genes present in E.…
Q: 10. Modify the diagrams below to reflect the activation and repression of lac operon. Use arrows,…
A: The prokaryotic gene regulatory system is known as operon system in which the expression of…
Q: that best fits the phrase below (1-20) Cis-acting B Post-transcriptional modification…
A: Francis Crick proposed central dogma. The RNA is formed from DNA with the help of enzyme RNA…
Q: On its chromosome, an E. coli cell has a genotype of lacI− lacZ+ lacY+ lacA+. It has an F′ factor…
A: Lac operon is studied extensively by using mutant strains of E.coli. It is studied under the domain…
Q: In prokaryotes, the trp operon is under ________ that ________ prevents RNA polymerase from binding.…
A: Amino acids are required for bacteria like E. coli to sustain. E. coli can ingest tryptophan, which…
Q: 1 Given the following genotypes, explain how the mutation (identified by a () superscript will…
A: Operon is a unit consisting of one or more systems that function coordinately under the control of…
Q: 10. Modify the diagrams below to reflect the activation and repression of lac operon. Use arrows,…
A: Lac operon contains genes involved in metabolism. The genes are expressed only when lactose is…
Q: You grow bacteria in media where the only carbon source is lactose (rich lactose media). Which of…
A: Introduction- Lysogen is defined as the strain of bacteria affected by a virus, i.e., a phage that…
Q: I. CAP-CAMP complex binds to the operator locus blocking the RNA polymerase. II. In the presence of…
A: The lactose operon (also known as the lac operon) is a set of genes that are specific for uptake and…
Q: 5a. The table below summarizes expression of B-galactosidase (lacZ) and permease (lacY) from the lac…
A: 5a) Lac operon is an inducible operon that is expressed in the presence of a substance termed…
Q: The glycerol operon has two structural genes that encode the enzymes Amairmerasa and isomerase, as…
A: The usage of carbohydrates as an energy source is dependent on the availability of the concerned…
Q: Choose the best options, by dragging and dropping the colour coded text boxes below, that fill in…
A: Operon is transcription unit of prokaryotic genome with consist of many contiguous structural genes…
Q: 1. Predict the effect of each situation on the Lac or Trp operon. Lac operon is ON Lac operon is OFF…
A: Operon is the group of genes that are expressed under the same regulatory sequences.
Q: F’ lac I- O+ Z+/ lac I+ Oc Z- the genotype indicated would lead to what type of expression of…
A: Bacteria contain multicistronic arrangements for the expression of genes that are involved in a…
Q: 1. Compare and contrast gene regulation of a Lac operon when there is little glucose in the…
A: The cellular environment has an impact on cellular action which is achieved by controlling the…
Q: 2. You are studying the regulation of the lactose operon in Escherichia coli, by measuring…
A: The lac operon is responsible for the entry and metabolism of lactose in E. coli as well as most…
Q: Determine the outcome for the lac operon genotype shown below: I*p*o°z*y /I*p*o*z°x* Assume lactose…
A: A group of genes that are transcribed under a single promoter and an operator is referred to as…
Q: Outline the operon theory using the lac operon as anexample
A: Operon consists of genes placed in sequential order. Lac operon has following genes- Regulator gene…
Q: Why do eukaryotic cells not have a lac operon? A. Eukaryotic cells cannot transcribe multiple genes…
A: Lac operon is a gene regulating unit present in prokaryotes. It consists of a promoter, repressor,…
Q: The lac operon regulates expression of genes required for the breakdown of lactose. Use the…
A: The lac operon regulates the expression of genes required for the breakdown of lactose through a…
Q: 6. Which of the following is true about E. coll's lac operon? If there is no lactose present, the…
A: Option 1. For the lactose transport and metabolism of in E. coli and other bacteria, the lac operon…
Q: According to the operon hypothesis, the Z and Y genes of E. coli are classified as structural genes,…
A: The Lac Operon is responsible for Lactose metabolism and transport in E.coli. This operon consists…
Q: Say you have an operon called the CAKE operon, it contains genes for the enzymes require to convert…
A: An operon consists of a set of genes regulated by a single promoter. The products of these genes are…
Q: Strain P77 has a mutation in the lacO that prevents it from being bound by the lacI protein.…
A: The operon model is applicable in bacterial gene regulation and also applicable in some lower…
Q: Under which of the following conditions would a lac operon produce the greatest amount of…
A: The “lactose operon” (lac operon) is the group of “3 structural genes” with a “single promoter.” It…
Q: The table below shows partial diploid E. coli with lac operon mutations For each mutant, indicate…
A: The lac operon is an operon or group of genes with a single promoter.
Q: The symbols a, b, and c in the table below represent theE. coli lac system genes for the repressor…
A: Answer a. a = lacO; b = lacZ; c = lacI . Explanation: You've been told that a, b, and c stand for…
Q: Matching type Choices are in the picture 11. regulating elements in the operon 12. ribosome…
A: Transcription is the process by which the information in a strand of DNA is copied into a new…
Q: G) A mutation has occurred rendering the regulatory protein unable to recognize the operator…
A: From the given information it is cleat that regulatory protein is activator (positive regulator) of…
Q: You are growing E. coli in a laboratory in order to study their operons. The growth media you are…
A: The prokaryotic gene regulation is known as operon system in which the expression of polycystronic…
Q: 9. A single base substitution mutation in lacY gene of the Lac operon would render the entire lac…
A: Gene regulation at the level of transcription in bacteria is achieved by the operon model. Operon is…
Q: Decide which operon each of the following characteristics applies to. Note: a description may apply…
A: Introduction "In E.coli And Other Bacteria, The Lac Operon Is An Operon Or A Set Of Genes With A…
Q: In your own words describe in detail what happens at the lac operon in each of the following…
A: Gene regulation at the level of transcription in bacteria is achieved by the operon model. Operon…
Q: To characterize the promoter of the gadA operon you made a series of deletion mutants removing…
A: Gad A gene expression is found in the bacteria. They have operon structure in which regulatory,…
Q: Under which of the following conditions would a lac operon produce the greatest amount of…
A: Lac operon is the operon which is part of the lactose metabolism present in the E. coli. Lac operon…
Q: Say you have an operon called the CAKE operon, it contains genes for the enzymes require to convert…
A: The operon model is considered as a cluster of functional genes that are activated in response to…
Q: 1) A. What is the difference between a repressible vs, an inducible operon? B. Using diagrams…
A: The answer is given below
Q: humber of mutations affect the expression of the lac operon in E. coli. The genotypes of several E.…
A: Lac operon is a genetic unit that produces the enzymes necessary for the digestion of lactose. It is…
Q: For a lac operon of genotype PPO*Z* , functional beta-galactosidase is ... (pick the best answer)…
A: Hi, Thanks For Your Question. Answer : Correct Option Is A (Never produced). I Gene Encodes For…
Q: In the ara operon in E. coli cells, AraC will bind to its specific target DNA when O a. when there…
A: AraC protein can shift from the state of its preference to loop DNA (when arabinose is absent) to…
Q: An E. coli cell as the following genotype for the lac operon system: I- OC Z+ / F’ I+. Which term…
A: The presence I+ repressor is dominant to the absence of a repressor I-. Oc mutants:- these are the…
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
An operon is a group of genes that are transcribed at the same time.
The lac operon consists of three genes which are involved in the processing of lactose sugar.One of the gene for the enzyme is beta galactocidase, which hydrolyses lactose into glucose and galactose.
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 1 images
- Read aloud V Draw Highlight 2. You are studying the regulation of the lactose operon in Escherichia coli, by measuring expression of the lacZ gene (i.e production of beta-galactosidase). (a) You identify several loss-of-function mutations in which lacZ is never expressed, in the presence and absence of glucose and lactose. What components of the lac operon could be mutated to produce this phenotype? List all possibilities. (b) You identify another loss-of-function mutation with the following expression pattern: Media + glucose - lactose + glucose +lactose - glucose - lactose - glucose + lactose lacZ expression Low Low High High What components of the lac operon could be mutated to produce this phenotype? List all possibilities.that best fits the phrase below (1-20) Cis-acting B Post-transcriptional modification Post-translational modification Reactive (R) group Trans-acting C Operon Nuclear localizationsignal Double-stranded RIA Shine-Dalgarno sequence Kozak sequence E site on ribosome Ps p riboeE8R3) A site on ribosome Constitutive F Allosteric transition Inducer ll ol g Repressor T G H. Nonsense codon Frameshift mutation W Chaperones Found upstream of AUG codons in bacteria, this binds the 3' end of the 16S rRNA of the 30S ribosomal subunit Addition of chemical groups to amino acids in a polypeptide Hidigel elnw eesel Poly (A) polymerase enzyme uses ATP as substrate to add a string of A nucleotides on to the 3'-OH of MRNA Jeiheg 1ot eninoaso uoy nielgxe 10 anoitamusas Tuoy elsta otehgo1qqs eedW 4 Is produced when both strands of DNA encoding a gene are transcribed simultaneously A class of proteins that arrest incorrectly or incompletely folded proteins 6. Occurs when allolactose binds Lacl protein causing…Which of the following lac operon genotypes would allow for functional versions of all the structural enzymes of the lac operon to be expressed constitutively even in the absence of lactose? Group of answer choices I+ O+ Z+ Y+ A+ I- O+ Z- Y- A- I+ OC Z+ Y+ A+ IS O+ Z+ Y+ A+ I+ O+ Z- Y+ A+
- The following is a sequence of the leader region ofthe his operon mRNA in Salmonella typhimurium.What bases in this sequence could cause a ribosometo pause when histidine is limiting (that is, when thereis very little of it) in the medium?5′ AUGACACGCGUUCAAUUUAAACACCACCAUCAUCACCAUCAUCCUGACUAGUCUUUCAGGC 3′1. The following are genotypes of merozygotes of E. coli with various combinations of lac operon mutations. Determine the phenotype with respect to beta-galactosidase (z), permease (y), and trans-acetylase (a) of each combination as U = uninducible, I = inducible, and C = constitutive. Choose from the following answers. i- p+ o+ z+ y- a+ / i+ p+ oc z- y- a+ Answer choices UII UIC UUU ICC CUC IUC CCU 2. The following are genotypes of merozygotes of E. coli with various combinations of lac operon mutations. Determine the phenotype with respect to beta-galactosidase (z), permease (y), and trans-acetylase (a) of each combination as U = uninducible, I = inducible, and C = constitutive. Choose from the following answers. i- p+ o+ z- y+ a+ / iS p+ o+ z- y+ a+ Answer choices ICC CCU UII IUC UIC CUC UUUA number of mutations affect the expression of the lac operon in E. coli. The genotypes of several E. coli strains are shown below. ("+" indicates a wild-type gene with normal function and "-" indicates a loss-of-function allele.) Please predict which of the following strains would have the lowest beta-galactosidase enzyme activity, when grown in the lactose medium. Orpt o* z* r* Orpt ot z* Y OrptoztY Orrotzr OrPotz*Y
- For the next two questions, consider the fec operon of Staphylococcus madeupiddis, which encodes an iron citrate uptake system. The fec operon promoter, called "Pfec", is normally off when no regulators are bound to it (like the lac operon promoter). The activator FecA senses iron citrate and brings the appropriate enzyme to Pfec to start fec transcription when iron citrate levels are high. The repressor FecB senses free iron atoms and prevents fec transcription when free iron levels are high by binding to an operator between the promoter and structural genes. MacBook Air DII F9 888 000 F8 80 F7 F6 F5 F4 F3 & 2$ 6. 7 8. 435. The genes shown are from the lac operon system of E.coli. The symbols a, b and c represent the repressor (I) gene, the operator (O) region, and the structural gene (Z) for β-galactosidase, although not in that order. Furthermore, the symbols written in the genotypes are not necessarily the actual sequence in the lac operon.The diagram below represents the tryptophan operon with the trp leader mRNA transcript enlarged to represent the AUG translation start codon, two consecutive tryptophan amino acid codons (UGGUGG), and 4 regions (1, 2, 3, and 4) that base pair to form different hairpin-loop structures in the MRNA leader region. Suppose a mutant bacteria has region 4 of the trp operon attenuator region mutated so that it cannot base pair normally. Would the bacteria grow in the absence of the amino acid tryptophan? (hint: in order for bacteria to grow in absence of tryptophan it should be able to synthesize its own tryptophan) Lead&r region trpE trpD trpC trpB trpA DNA 5' 3' Transcription trp leader sequence MRNA UGGUGG 1 (tryptophan codons) AUG UUUUUU No There is insutficient information to answer the question. O Yes
- Answer as Directed. Below is the model of a lac operon. lac I lac Z с promoter operator lac Y lac A DNA +1 1. What are structural genes? Are the lac structural genes transcribed in the absence of lactose? 2. What is the role of the promoter and operator sites in the operon? 3. Is the repressor protein bound to the operator site in the absence of lactose? In its absence? 4. Under what nutritional circumstances (high or low glucose) is CAP bound to cAMP? 5. In the absence of lactose and the presence of glucose in the bacterial growth media, what proteins are bound to the lac control region? Is the operon being transcribed then? 6. In the presence of lactose and the presence of glucose in the bacterial growth media, what proteins are bound to the lac regulatory region? Is the operon being transcribed then? 7. In the presence of lactose and the absence of glucose in the bacterial growth media, what proteins are bound to the lac control region? 8. Why is it adaptive for a bacterium to not…The diagram below represents the tryptophan operon with the trp leader mRNA transcript enlarged to represent the AUG translation start codon, two consecutive tryptophan amino acid codons (UGGUGG), and 4 regions (1, 2, 3, and 4) that base pair to form different hairpin-loop structures in the mRNA leader region. Suppose a mutant bacteria has region 3 of the trp operon attenuator region mutated so that it cannot base pair normally. Would the bacteria grow in the absence of the amino acid tryptophan? (hint: in order for bacteria to grow in absence of tryptophan it should be able to synthesize its own tryptophan) Leader region trpE trpD trpC trpB trpA DNA 5' 3' Transcription trp leader sequence MRNA AUG UGGUGG UUUUUU 1 2 3 (tryptophan codons) There is insufficient information to answer the question. Yes No O O1. Draw a diagram of the lac operon. PO I+P+O+Z+Y+ I+P+OcZ+Y- I-P+O+Z+Y+ Lab section (circle): lacz gene lac Y gene lacA gene I+P+O+ZY/IPO+Z+Y- 2. The promoter (P) is the start site of transcription through the binding of RNA polymerase before actual mRNA production. Mutated promoters (P) cannot bind RNA polymerase, so no mRNA is made. In the table below, make predictions about the expression of ß-galactosidase and permease for different partial diploid (F') genotypes. Do this for E. coli growth on two different types of media - one without lactose, and one with. Use a to mark where there is no enzyme produced, and a + to mark where the enzyme is made. The first genotype has all wild-type alleles, and has been filled in as an example. Genotype IPOCZ+Y/I-P+O+Z-Y+ ISP+O+Z+Y/I+P+O+Z*Y* CR 1:00 Lactose absent B-galactosidase Permease R 3:-00 + R 6:30 Lactose present B-galactosidase F 10:00 Permease