1. For each of the sequences, place an X in the box to indicate the process most immediately affected by deleting the gene sequence. Only choose one process for each sequence. Process most immediately affected RNA processing translation Gene Sequence deleted replication transcription Shine Dalgarno AUG codon oric Pribnow box DnaA box -10 sequence 3' splice site Ter site TATA sequence UGA codon primase guanlyltransferase enhancer mediator
Q: In problem 2e, how can you identify added mutations?
A: Mutations are changes in the base pairs of DNA that are heritable to the offspring. Mutations caused…
Q: 2. Complete the leading strand and the complementary strand vith the 5'and 3' ends and identify he…
A: DNA replication is the process by which a new DNA molecule is formed and this process is known as…
Q: 8. The following diagram represents the Christmas-tree-like structures during transcript On the…
A: E. Eliminators are viewed downstream of the quality as deciphered, and ordinarily happen…
Q: When RNA polymerase transcribes DNA, only one of the two DNA strands is used as a template.…
A: Transcription is the process in which a DNA strand gets transcribes into RNA by the help of RNA…
Q: 2. The following double stranded segment of DNA is part of a protein coding gene. The segments in…
A: The genetic information of all living organisms (except some viruses) is stored in the cell in the…
Q: A portion of an mRNA attached to a ribosome reads: 5′ GACAUGAACAGC 3′ If a tRNA with a methionine…
A: In this question, we are given with a portion of mRNA which has a sequence 5' GACAUGAACAGC 3'. mRNA…
Q: occasionally, an effor occurs during DNA replication that changes the nucleotide sequence. Aven that…
A: The process by which DNA is copied to RNA is called transcription, and that by which RNA is used to…
Q: 1) Complete the following tables by filling in the DNA sequence, MRNA codons, and the amino acids…
A: The genetic material DNA is converted into RNA and this mRNA codes for a specific protein which is…
Q: 4. The template strand from the previous question is mutated to the DNA sequence shown below: 3' GTC…
A: transcription is the process by which messenger rna is made from dna .
Q: The double-stranded DNA sequence for a bacteria is shown below and it's coding for a hypothetical…
A: The central dogma of life involves DNA replication, transcription, and translation into proteins.…
Q: 2. What are IC TArE Codon marks theste at wNch translati PART D. Directions: Identify the mutated…
A: In the given question the normal DNA is TAC-CCC- GTC- ACC- GCC- TAT-ATC. The normal RNA formed from…
Q: Would the coupling of the processes shown in Figure 17.24 be found in a eukaryotic cell? Explain why…
A: Transcription is the process of synthesis of mRNA molecules from the DNA present in a cell. This…
Q: The diagram below shows a section of double-stranded DNA undergoing both transcription and…
A: DNA replication is the process in which the DNA copies are made by the action of several enzymes…
Q: 1. Which is the correct of mRNA strand if you have a tRNA of GCA-AUG-UCC-CGU? A.…
A: Introduction Genetic code or codon is a three letters nucleotide bases present on m RNA which code…
Q: table opposite shows the standard (coding strand et codes for the 20 amino acids involved in protein…
A: DNA is a nucleic acid.
Q: DNA Leading strand: 5' AAA ATA | CGC TTT| TTA ATT | AAC CCC GGG 3' A I B |C| D Exons: A, C, D…
A: The process of synthesizing RNA from the genetic information encoded by DNA is called Transcription…
Q: 7 Which of the following is the correct polypeptide chain for the mRNA strand shown below?…
A: A codon is a group of three nucleotides in an mRNA grouped to code for a particular amino acid. The…
Q: 1. Transcription: Write out the sequence of mRNA that would result from transcription of the…
A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…
Q: 1. During RNA splicing, the of the precursor mRNA are being removed. Exons Introns Promoters…
A: RNA splicing is a process by which non coding sequences of RNA are removed. The coding sequences…
Q: 2. Identify the following structures when given images such as the ones below: ● process of…
A: Introduction The cell is the basic structural and functional unit of life present in all living…
Q: 3. Below is part of the DNA genetic code for six amino acids. TTT AAA Codes for phenylalanine САА…
A:
Q: Which statements are true? Explain why or why not.1 The consequences of errors in transcription…
A: Note: As Per Guidelines, We Can Answer One Question At A Time. Ask Again To get rest answers.…
Q: Given the DNA sequence 5′-AUG GCU AGA GUU GAA AAA-3′, which of these sequences represents a silent…
A: According to bartleby expert guideline we are allowed to answer only one question. Kindly repost the…
Q: 8. Helps RNA polymerase recognize and bind the promoter. 9. Assemble the 30S, 50S ribosome, mRNA and…
A: The production of new DNA from the old DNA is known as replication. The production of RNA from DNA…
Q: 8. For the double strand DNA molecule below, assume the 3' DNA strand acts as the template for…
A: The process in which the DNA is converted into mRNA is called transcription and in which mRNA is…
Q: Telomerase Nucleoside RNA Polymerase I RNA Polymerase II RNA Polymerase IIIon E of qu sven UOY…
A: As per the bartleby guidelines we are suppose to answer only first 3 questions for fill in the…
Q: 1. The two sequences shown below are complementary to each other. T or F GTCGAC CAGCUG 2. Telomerase…
A: The image shows 10 statements. We have to determine whether the statement is True or False. The…
Q: 1.This is responsible for breaking hydrogen bonds between complementary nucleotides of a DNA duplex…
A: Note - Since you have asked multiple questions, we will solve the first question for you. If you…
Q: pc*00ATAAADDATATAJOTTAA 1. Use the genetic code table and the information in the diagram below to…
A: Translation, in molecular biology and genetics, is the process by which ribosomes in the cytoplasm…
Q: The following sequence of DNA is part of the normal, wild-type gene. 5'TAC CGG GAC TTG AGC CGA…
A: A single nucleotide from the DNA is deleted in nucleotide deletion. Although the single nucleotide…
Q: 5. DNA is made of two strands that are antiparallel. If one strand runs from 3' to 5' direction the…
A: Transcription is the synthesis of RNA and translation is the synthesis of proteins. There is a…
Q: What amino acids are specified by the following base triads on DNA? a. TCA b. CCt c. GGC d. GAT e.…
A: A genetic codon is a triplet nucleotide sequence of RNA molecules that were formed from the…
Q: . Which of the following repair mechanisms can lead to frameshift mutations? a. Nonhomologous…
A: 1.Answer-- correct option is (b) Nucleotide excision repair
Q: Can you please answer number 24
A: Answer 24. Genetic code is a set of rules used by living cells to translate information encoded…
Q: A.) Deletion mutation is a loss of a single base by damage. B.) Point mutation is when a nucleotide…
A: "Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: During DNA replication a mutation occurs that reuskt in the following chnage in the corresponding…
A: It is the process in which ribosomes in the cytoplasm or endoplasmic reticulum synthesize proteins…
Q: Both strands are shown; the top strand reads 5' to 3' left to right, while the bottom strand reads…
A: The central dogma in both prokaryotic and eukaryotic cell consists of a series of steps including…
Q: = exons = introns Transcription termination site (also poly A site) Promoter Start of transcription…
A: Transcription is the process which consists of several steps of DNA-based gene expression. Here a…
Q: Shown is a segment of DNA with its promoter and terminator. Start and end of transcription are…
A: Transcription is the phenomenon in which one stranded RNA is synthesized from DNA strand . But RNA…
Q: Do you think it matters which protein is mutated? Is one protein more important than another? How…
A: Exons and Introns are the regions of mRNA, while maturation of mRNA (splicing) the Exons are kept…
Q: 4. Draw and label the Transcription process. 5. Draw and label the Translation process.
A: Transcription is the process in which RNA is made from DNA, while translation is the process in…
Q: 3. Below is the sequence of DNA template for transcribing a segment of mRNA. 5 ATGTGGTTATAGCTAACC 3…
A: In the question, we must write the complementary base of the sequence. Our mRNA sequence will be in…
Q: 1. Which of the following enzymes can polymerize deoxyribonucleotides into DNA? A) Primase B) DNA…
A: There are different biomolecules present, and they include nucleic acids, proteins, lipids,…
Q: Elongation factor __________ reactivates arrested RNA polymerase II
A: Molecular biology is the branch of science that studies the structure, composition, function, and…
Q: 1) Which of the following complexes contributes to the transcription of cyclin E? a) Cdk1/cyclin A…
A: 1) The cell cycle is a sequence of events that is occurring in a ordered fashion which results in…
Q: 7. Complete the following diagram which describes a small eukaryotic open reading frame, by filling…
A: DNA ( Deoxyribonucleic acid ) is two stranded structure which functions as genetic material in most…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- First Letter A G U с 22. Using the provided "Genetic Code-Reference" answer the following question. Based on the following DNA template strand, write out the amino acid chain produced. 23. Consider the following mRNA base codon sequence 5'-AUC-GAA-3' and the provided "Genetic Code-Reference". Genetic Code-Reference UUU UUC UUA UUG CUU CUC CUA CUG (mutated or silent) (mutated or silent) b. Briefly explain your reasoning for each. (be sure to include both parts) AULLY AUU a. Label which of the following would result in a mutated amino acid sequence or a silent mutation. (May help to first determine the original amino acid sequence, then compare to mutations) U Phe mRNA codon sequence: anticodon sequence: amino acid sequence: Leu Leu 5'-AUA-GAA-3' Val 5'- AUC-GAC-3' AUC Ille AUA AUAJ *AUG Met/Start GUU GUC GUA GUG UCU UCC UCA UCG) CCU) CCC ccc CCA 000 CCG ACU ACU ACC ACA ACG, C GCU GCC GCA GCG Second Letter Ser Pro Thr 3'-CAA-GTC-TGT-5' Ala UAU UAC) Tyr Туг A **UAA Stop UAG Stop CAU] CACJ…pcc300ATAAADATATAOOTTAA 1. Use the genetic code table and the information in the diagram below to determine the amino acids that would make up the portion of the polypeptide shown. Include information for a key as well. DNA template 3' G CATA ACAGAGGATT-5' al bnsua AMAm pniwollot erfT E transcription s yd bnsita ebitgeqylog s sidmeaze of beae RNA strandUU UAOUOUU A-emoaodin 5'-CGUA AUUGUC UCCUUA- 3' J J JL erit o elinW (s) translation bluow terdt aspnso sigootiwsone polypeptide viemetis ns ebivo19 (d) ent ot etslanT Key:me e File Content 911 Edit verview....pdf X PDF view Histor Biol 140 X Doordena Content acconline.austincc.edu/ultra/courses/_891351_1/cl/outline X Begin: X O Tutorial X Match each term with its best description. You may use each answer choice more than once. location of transcription in prokaryotes RNA triplet on tRNA which pairs complementary to an mRNA codon to ensure correct amino acid is brought into the ribosome during translation 18 Unit 3 X location of translation in all cells process of rewriting DNA code into mRNA code mRNA triplets which code for a specific amino acid Unit 3 ( x process of converting an mRNA transcript into a seuence of amino acids making up a polypeptide folded RNA that carries amino acids and transfers them to the ribosome during translation makes up ribosomes along with proteins location of transcription in eukaryotes intermediate between DNA and protein interpreted as codons specifying certain amino acids Content Your disk is alme Save space by op A.…
- 3’ – ACCTCTTACTTTTATATATAGGGAAGACTAATTGTC – 5’ Transcribe the template strand be sure to use the 5’ and 3’ directions appropriately on the mRNA, feel free to rewrite the DNA strand if needed to make it easier to interpret. Make sure to label the mRNA with a "5'cap" and place 10 A's to form the poly-A tail.Below is a sequence of DNA. 5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' How many codons are in the longest ORF? What is the frame of the shortest ORF? How many AA are in the shortest ORF?Basisse triplet nommer/ Base triplet number 1 2 3 4 5 6 7 Menslike DNA-volgorde / Human DNA sequence ATG TGT CCA TTA ACG TGC ACA Name the codon that is formed from base triplet number 2 on the DNA sequence. Write down the names of the amino acids coded for by base triplets 6 and 7. Write down the full names Draw the structure of the dipeptide Thr-Cys at pH7. Clearly indicate the following: the amino terminus (N) the carboxyl terminus (C) a peptide bond an α-carbon atom If a mutation changes base triplet 1 from ATG to ATA, why will this not change the protein formed? E.The following is a sequence of base triplets in DNA F.If guanine, found in the first base…
- BM4_DNA AND PROTEIN S X /1FAIPQLSDP_g5B-629FSHNpGnTMIEppLS4A71zBd4vcUBqNUILubXONw/formResponse 4. What is the nitrogen base pair of Adenine in transcription? O Cytosine O Uracil O guanine O thymine 5. The central dogma of Molecular Biology states that There are four nitrogen bases in DNA, two purines (adenine and guanine) and two pyrimidines (cytosine and thymine). Which process is not included in the central dogma? duplication transcription translation O translocation Leadpleoseg 1su Third Base ne following questions refer to Figure 17.2, a table of codons. Second Base nnn UUC UAU non Tyr UCC UAC UGA Stop dois UGG UUA JOS UCA UAA ne UUG UCG UAG di dois CCU CAU CGU CUC SIH CGC CCC CAC CUA no7 CGA CCA Old CAA CCG CAG CGG AAU AUC JOS USV AGC ACC AAC AUA ACA AAA AGA AUG Met or Start Lys ACG AAG GCU GAU dsy GGC GUC GCC GAC Ala Gly GUA GCA GAA GGA GUG GCG GAG GGG Figure 17.2 A peptide has the sequence NH2-phe-pro-lys-pro-gly-phe-pro-COOH. Which Of the following sequences in the coding strand Of the DNA could equal the code for this peptide? a. 5' GGG-AAA-TTT-AAA-CCC-ACT-GGG b. 5' TTT-CCC-AAA-CCC-GGG-TTT-CC c. 3' AUG-AAA-GGG-TTT-CCC-AAA-GGG d. 3' UUU-CCC-AAA-GGG-UUU-CCC e. 5' TTT-CCC-AAA-GGG-TTT-CCC26. What is the start codon and the corresponding amino acid for which it codes? FIISI DASO U G UUU UUC UUA U CUU CUC CUA CUG AUA AUG GUU GUC GUA GUG PHE AUU AUC ILE GAU-ASP LEU MET or START LEU GUA-VAL AGU-SER VAL AUG- MET UCU UCC UCA UCG C CCUT CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Second base SER PRO THR ALA UAU UAC UAA UAG CAU CAC CAA CAG A GAUT GAC GAA 1 GAGJ STOP UGU TYR CYS UGC UGA STOP UGG TRP G HIS GLN AAC ASN AAA AAG J LYS ASP GLU G CGU CGC CGA CGGJ AGU AGC. AGA AGG GGU GGC GGA GGG >ARG SER ARG UCAG GLY UCAG UCAG UCAG THILD DASO REQUIRED E ce
- Complete the labels for the following diagram of translation. NOTE: A is the product of this process, B is a protein that recognizes the stop codon, C and D are types of RNA A B C Write your response here... Write your response here... Write your response here... Write your response here...48 Second letter If any single nucleotide is deleted from the DNA sequence shown below, what type of mutation is this? UUU U UUC UUA UCU Phe UCC UAU UGU Cys ANTISENSE 5' GGACCCTAT3' UAC Tyr UGC UAA Stop UGA Stop UAG Stop UGG Trp Ser UCA Leu UUGL" UCG CUU CU CAU) His CAC) CGU CGC CGA Arg CUC C Leu Pro CAA1 Gin CAG) CUA CCA CUG CG CGG AAU AAC Asn AGC AAA AAG Lys AGG Arg AUU ACU AGU Ser AUC lle ACC Thr AUA ACA AGA AUG Met ACG GCU GCC GUU GAU] GGU GUC Val GAC Asp GGC Ala Gly GUA GCA GAA GGA Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a FRAMESHIFT SILENT NONSENSE MISSENSE Third letter First letterBelow is a sequence of DNA.5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' How many "reading frames" can be identified for this sequence? How many "open reading frames" can be identified for this sequence? What is the frame of the longest ORF? How many codons are in the longest ORF? What is the frame of the shortest ORF? How many AA are in the shortest ORF? Using the one letter code for Amino Acids, what is the predicted AA sequence of the shortestORF (from N to C-terminal end)? Using the one letter code for Amino Acids, what is the predicted AA sequence of the longestORF (from N to C-terminal end)?