Answered: 1. Why do waterfowls posses an…

1. Why do waterfowls posses an intromittent organ that is highly elaborated? 2. What happens if you press down on the skin of a screamer? Why? 3. Please characterize the mating system of rheas.

BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)

10th Edition

ISBN:9781305967359

Author:STARR

Publisher:STARR

Chapter39: Animal Behavior

Section: Chapter Questions

Problem 9SA

See similar textbooks

Related questions

Q: Adaptive radiation is when populations diverge from a common ancestor into new species, each of…

A: Adaptive radiation/ convergence is a phenomenon in which populations can undergo two processes:-…

Q: Referring to Figure 17-32, draw an inviable product fromthe same meiosis

A: Introduction: Pseudo-linkage is said to occur when linkage is observed between two loci that were…

Q: Vhat is the driving force behind divergent evolution? Explain.

A: Divergent evolution happens when a populace of animals or plants is parted into two gatherings by a…

Q: Directions: Read and understand the situation very carefully. Hanabi, a grade 12 student have…

A: The examination of the evolutionary development and connections among or even within groups of…

Q: Debra weighs 154 lbs and completes a maximal GXT. It was determined she has a maximal MET capacity…

A: MET: described as the ratio of the metabolic charge (power consumed) in the course of…

Q: TACTGCCTCCCCATAAGAATT

A: Transcription is the process in which a gene's DNA sequence is copied (transcribed) to make an RNA…

Q: The acquisition of memories can be demonstrated in rodents on a T-maze task. In this task, a food…

A: The task described the homeostasis and growth factor of mice . The innate and adaptive behaviour…

Q: Calculate the number of cells according to the following data Ng- 1x 104, = 0 35h-1, 24 hours,…

A: This is the question related to the growth rate. Here u is the growth rate constant. Bacterial cells…

Q: For genotype: repP¯ lacP lacP* lacO* lacZ* lacY Select the best description of permease activity in…

A: A) Permease activity:- Lactose Present; Glucose Present-- 4.lower than basal. Lactose Present:…

Q: A wealthy elderly couple die together in an accident. Soon, a man shows up to claim their fortune,…

A: The alleles are the alternative forms of a gene that are located on the same locus of a homologous…

Q: As a Dentistry student, what do you think is the importance of studying all the cranial nerves.

A: The cranial nerves are a group of 12 nerves that run along the back of your head. They also assist…

Q: A patient has just been brought into the Accident and Emergency (A&E) department of the local…

A: The stock solutions can be diluted to achieve the desired concentration. The calculations are based…

Q: What is mitosis? What is the importance of mitosis?

A: Cell division is the process by which a cell can divide itself into two cells. the process of cell…

Q: Which statement about energy flow in ecosystems is accurate? A.Energy flow reaches an equilibrium…

A: Environmental science is one of the sciences that we must learn that every living thing on this…

Q: Explain why the following statement are incorrect.. rewrite them to make it correct 1) evolution is…

A: Evolution can be described as the gradual and continuous change in organisms. It is the process by…

Q: The enzyme that removes the RNA primer from the Okazaki fragment is: A DNA ligase B DNA gyrase (c)…

A: The double standard DNA molecule is produced by the action of DNA volume range and the process…

Q: What are the divisions of the nervous system? 2. Differentiate the functions of the endocrine and…

A: Smallest function unit of nervous system is neuron. Various neurons are connected to each other and…

Q: Question 23) For these three situations below, describe whether there are changes in humoral,…

A: MC4 receptors reduce the food intake while elevating energy utilization . Action of this receptor…

Q: In 1947, Donal Hebb took some rats home from his lab at McGill University. Hebb let these rats grow…

A: Main morphological difference between neurons of rats growing in laboratory v/s rats growing in…

Q: How the presence of Pseudomonas aeruginosa in lungs aggravate the condition of patient having Cystic…

A: The airways of patients with cystic fibrosis (CF) are exceptionally complicated, concerned with…

Q: Can two normal individuals of the same species with sexual reproduction have identical genomes and…

A: The karyotype of an organism depicts the arrangements of its chromosomes. It is used to demonstrate…

Q: Column A Column B Column C I. a. Spherical/globular A. Epithelial I. b. Striated, multinucleated,…

Q: 2. Assume 250 base pairs to be responsible for a particular portion of mRNA molecule. What is the…

A: bp = base pair—one bp corresponds to approximately 3.4 Å of length along the strand 1angstrom (Å),…

Q: 1. The group of Leonor and Junior conducted an experiment about the fragmentation of planaria.…

A: In this, the given paragraph includes the experimental process and the observations of…

Q: quality assurance

Q: The fact that some eukaryotic rRNAs are self-splicing indicates that A RNA structures are highly…

A: In eukaryotes, rRNA have a sigma factor which makes the self splicable and hence the highly variable…

Q: Question 8 Why is replication called semi-conservative? A not all leading strands are conserved B…

A: During DNA duplication, is the method to copy DNA stands when new cells are formed.

Q: This figure can be used to represent the sequence of events leading to the evolution of dark-furred…

A: Evolution is the change in the characteristics of a species over several generations and relies on…

Q: true or false: crossing over during meiosis is responsible for creating unique combinations of…

A: Meiosis or reduction division is a characteristic feature of all those plants and animals that…

Q: Which of the following is the inner most layer of human eye? a) Retina b) Choroid c) Sclera d)…

A: Introduction - Our visual organ is the eye. Because of its intricate construction, an image can flow…

Q: What is special about the coloring of most tinamou eggs? 2. What ability do tinamous have that…

A: 1. The colour of the tinamou's eggs is due to the interplay between pigment coloration and what is…

Q: Question 1 In E. coli, the leading strand is synthesized discontinuously while the lagging strand is…

A: Replication of DNA It is the process through which a double-stranded DNA molecule is copied to form…

Q: All of the following describe a gamete, EXCEPT: a) sperm b) haploid c) zygote d) egg

A: Gametes are an organism's reproductive cells. They are also referred to as sex cells. Female gametes…

Q: Match the following Prompts An AT-rich region found in eukaryotic promoters is called the box. The…

A: 1. An AT rich region found in the eukaryotic promoters is called the "TATA box". The consensus…

Q: what is bacillus megaterium? must be in essay form.

A: Microbes are minute living creatures that must be identified with specialized scientific equipment…

Q: vectors. Examine Figure 2 below. Provide three (3) qualitative descriptions of the P. falciparum…

A: Plasmodium falciparum is the causal agent of malaria in humans. It is transmitted to humans by the…

Q: Natural selection favored dark-colored fur in the rock pocket mouse. The selective force on the…

A: Natural selection It is a natural biological process where organisms adapt and change there…

Q: Which of the following are examples of species interactions where one species benefits and one…

A: Parasitism is the relation in which one species is benefitted and the other is harmed. In…

Q: Neurotransmitters are released from a neuron when the action potential reaches the end of its axon.

Q: . What is Ringworm? What are the different types of ringworm?

A: Ringworm is a type of skin infection caused by a fungus that affects the skin. It is a contagious…

Q: A cell experiences a mutation where the DNA polymerase III enzyme can now add nucleotides to either…

A: A "nucleic acid" is a linear polymer of nucleotides that is a component of the cell's information…

Q: Chapter 23- Diseases of the Digestive System Match the description on the left side to the correct…

A: INTRODUCTION Answer to the question 41-50 is given below.

Q: 9. What slide preparation technique should you use for the following research goals? Briefly justify…

A: Answer :- a) Maceration technique In maceration the complex substance is broken down into simple…

Q: Rain falls on a fertilized agricultural field after a farmer has harvested the crop. Which…

A: Macronutrients of plants include Carbon, Nitrogen, Phosphorous along with the role of water. In…

Q: 1. Please describe the behavior of cranes. 2. How do peregrine falcons see the world?

A: Behaviour of Cranes.. #The cranes are diurnal birds that vary in their sociality by season and…

Q: On the planet of Caracas, in the Stellar Solorais KaChunka Galaxy, there is a population of…

A: Given: The phenotype of interest is Peanutus01. There are two alleles for the autosomal gene…

Q: Which of the following is not an example of homeostasis? Changing temperature Constant blood…

A: Homeostasis It is defined as the state of constant internal conditions( physical and chemical)…

Q: 10) Fill in the blanks found in the column on the right with the appropriate term(s) from the column…

A: Different types of cells that perform same function and originated from the same embryonic germ…

Q: You implant a sample material subcutaneously in the back of a rabbit model in an effort to evaluate…

A: Injury, blood material interactions, provisional matrix construction, acute and chronic…

Q: humectants as food additives.

A: Food additives Food additives are substances that when added to food increase their flavours, taste,…

Concept explainers

Ecological Interactions

The study of the ecological interactions between living beings and their physical environment, including humans, is ecology. It aims to understand the crucial links between plants and animals and the world around them. Ecology also gives knowledge on the advantages of ecosystems and how we may use Earth resources to ensure that future generations have a healthy environment.

Question

1. Why do waterfowls posses an intromittent organ that is highly elaborated?

2. What happens if you press down on the skin of a screamer? Why?

3. Please characterize the mating system of rheas.

4. How is the populationof rheas that has taken residency in europe faring?

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

1. Members of Suliformes do not develop brood pathces to incubate their eggs. What do they do instead? 2. Please describe nest building behavior in the hamerkop.
1. What do you think is the adaptive value of this bizarre behavior when the urchins are actively foraging on their feeding ground? 2. Explain in terms of different adaptive behaviors to maximise growth, survival & other traits that contributes to the fitness of the species in a highly variable coastal environment.
1. What causes the light pink to bright red coloraion of most adult flamingos? 2. Please describe the eating apparatus of flamingos. 3. Why does only one nestling of Suliformes survive when 2-3 eggs are layed? 4. Wat do members of Suliformes do to incubate their eggs since they don't have brood patches?
Explain the evolution of alternative male reproductive strategies within a single species. Give examples. nool deminerER What can less dominant males do? morebeemto lemates Compensatory mating strategies 1. Forming friehdships with a particular female (babbons). 2. Preejaculationfigienas). 3. Rape (ducks seorpionflies). 4. Satellite males ("parasitize successfulmales) Highand loakung mae s ors were found a have cs ofemales Du he hg arng mae had more cmso lesales during estr Nghe chance to produce Makingthe-best-of-a-bad-jab reproduotive strategy Conditional mating strategies: Co-existing reproductive strategies Genetic capacity for two altermative mating strategies (decision" is made during development, depending on nutrientavailability) Big horn, small testes OR Small horn, large testes Three different forms of sponge isopod males CS Scanned with CamScanner
1. Please describe the courtship display of members of Phaethontiformes. 2. Members of Suliformes typically lay 2-3 eggs, but it is rare that more than one nestling survives. Why?
Brood parasites ensure their reproductive success by the following mechanisms EXCEPT O a. making their host vulnerable to predation O b. producing eggs closely resembling that of the host O C. producing young that give off smells and sounds similar to those of the host O d.producing a large number of eggs O e. utilizing the host parental care mechanisms
1. Members of Suliformes typically lay 2-3 eggs, but it is rare that more than one nestling survives. Why? 2. Members of Suliformes do not develop brood patches to incubate their eggs. What do they do instead? 3. Why to tropic birds lose fat before their first flight? 4. Please describe the courtship display of members of Phaethontiformes.
6. Describe the feeding biology of centipedes, spiders, mites and beetles. Compare and contrast these with the sexual biology of these same animals. How might differences in feeding relate to differences in mating behavior?
6. The American toad mates in early summer, and the Fowler's toad mates in late summer. Due to seasonal changes, an American toad attempts to mate with a Fowler's toad. What would be the outcome? The offspring is not likely to survive. O The toads will not be able to successfully mate. The offspring would be sterile. The offspring may be born with a deformity.
Think back to Section 44.6. When researchers moved guppies from populations preyed on by cichlids to a habitat with killifish, the life histories of the transplanted guppies evolved. They came to resemble those of guppy populations preyed on by killifish. Males became gaudier; some scales formed larger, more colorful spots. How might a decrease in predation pressure on sexually mature fish allow this change?
1. Who is Wisdom and what record does she hold? 2. What are salt glands and why do seabirds have them? 3. Why do pelicans hold the symbol of self sacrifice? 4. Please describe nest building behavior in the hamerkop.
i Which one of the following is NOT a problem associated with the used of chemical insecticides? a. Insects can develop resistance to them b. They can be harmful to beneficial insects such as pollinators c. They may be harmful to human health d. They are expensive and cannot be stored for long ii Which if the following best describes courtship in insects? a. Performed by males; main functions to induce sexual receptivity and aid species recognition b. Performed by females; main function to induce sexual receptivity c. Performed by males; main function to induce sexual receptivity d. Performed by males; main function to aid species recognition e. Performed by males; main function to aid species recognition