2c) If the whole potoroo genome is 4.2 x 10' bp, and the highly repetitive DNA in the potoroo genome is composed entirely of copies of the sequence 5'AAGACT' and its complement, how many copies of this sequence are present in the potoroo genome?
Q: What happens, metabolically, to the body id the lactate is not cleared from the muscles?
A: Introduction Oxygen and nutrients are heavily used by muscle tissue. Its consumption is undoubtedly…
Q: In a diploid organism, Meiosis 1, and line up at the metaphase plate during Mitosis. line up at the…
A: Mitosis is essential in embryonic development because it allows a single-cell zygote to grow into an…
Q: 3. Why are celluloses often used as supports to separate large biologically active proteins?
A: Introduction Cellulose is a polymer composed of long chains of beta glucose molecules that are…
Q: Students are performing an experiment to understand the transfers of carbon between a photosynthetic…
A: BTB is a pH indicator, it is of blue colour and as the pH decreases or the solution becomes acidic…
Q: F2 plants segregate colored : colorless. If a colored plant is picked at random and selfed, what is…
A: Introduction :- The term "progeny" describes the offspring of living things like plants and animals.…
Q: 4) In frost moths, two alleles of one gene determine the character difference of spotted versus…
A: The alleles are the alternative forms of a gene that are located on the same locus of a homologous…
Q: Below are six faces. Each face represents a species. Seven characters are listed in the table, along…
A: Introduction : A genetically determined characteristic or condition is known as trait. It is the…
Q: 5. How did you enrich for spore forming bacteria from the soil sample?
A: Introduction :- Bacillus (aerobic) and Clostridium (anaerobic) species are examples of spore-forming…
Q: Two different house Flys were crossbreed for 2 generations. The female was a wild fly and the male…
A: A trait is a characteristics features that is unique to specific individual . Each trait is…
Q: Define about Chromatin Modifications ?
A: The term "chromatin" describes the DNA and protein combination which makes up the chromosomes…
Q: When an action potential depolarizes the axon terminal, calcium enters into the axon terminal…
A: Neurotransmitters are chemical messengers for transmitting neural information. Neurotransmitters are…
Q: A nutritionist is interested in collecting data to develop a healthy eating program at a local high…
A: A graph is a pictorial representation or diagram that represents data or values in an organised way.
Q: 13. Identify five layers of the epidermis, dermal papillae, and melanocytes in the image below:
A: Skin is a external vital shield around the body and is a part of integumentary system which form…
Q: Which is the last stage of phage replication allowed to proceed before a temperate phage enters the…
A: Since comparable mechanisms have been seen for eukaryotic viruses, that can either develop a latent…
Q: These cells fire graded potentials or graded potentials or both?
A: A nerve is a component of the nervous system's peripheral nervous system. It facilitates…
Q: need a good explanatory answer. Proteins are made of ___,____,____ Proteins are the _____________…
A: Proteins are complex molecules that perform the majority of the work in cells. They are crucial to…
Q: If the concentration of the bacterial nutrient, maltose, is higher outside the cell than inside the…
A: Passive transport A type of transport of molecules across the cell membrane where no expenditure of…
Q: Define about this- Cancer Cells Contain GeneticDefects Affecting Genomic Stability ?
A: Cancer is a condition when a few of the body's cells grow out of control and migrate to other bodily…
Q: . Mice normally have one yellow band on each hair, butvariants with two or three bands are known. A…
A: Inheritance is the phenomenon of the passing of genes from one generation to another. The genes code…
Q: Investigators enrolled 100 diabetics without eye disease in a cohort (follow-up) study. The results…
A: The incidence rate is a measurement that provides how quickly a disease is transmitted in a…
Q: What are the primary nutrients and how are they metabolized by cells?
A: Introduction Our food comprises three primary nutrients: carbohydrates, proteins, and fats. These…
Q: In fruit flies, Yellow body (E) is dominant to dark body (e). On a different chromosome, Long…
A: 1) The given information: E is the dominant allele for yellow bodye is the recessive allele for dark…
Q: Given an equal amount of photons, what is the order of increasing effectiveness of blue, red, green,…
A: Photosynthesis The production of glucose molecules by green plants in the presence of sunlight.
Q: can you discuss the role of alternate medicine and holistic approaches to health in the current…
A: Introduction Alternative medicine is any practice that aims to attain the healing effects of…
Q: What clinical and laboratory findings would lead to a diagnosis of liver cirrhosis?
A: Acute or chronic liver damage which can be caused by various liver diseases like hepatitis or due to…
Q: Describe how to use a micropipette.
A: Introduction Biology is a branch of science. Bio means life and ology means study. Biology is the…
Q: 10,000 individuals are sampled from a population and are found to display one of three blood types:…
A: Since you have asked a multipart question, we will solve the first three questions for you. If you…
Q: Bacteriophage lambda Describe the method used to retrieve your gene of interest from the plaques.
A: The genomic library is critical in genomic investigations, whether to determine the link between…
Q: QUESTION: Compare and contrast proteins and nucleic acids. What do these biomolecules have in…
A: A biomolecule, also known as a biological molecule, is any of the numerous substances produced by…
Q: Please answer fast and of both Which of the following are transcribed from DNA? A. rRNA, mRNA,…
A: Introduction :- Deoxyribonucleic acid is a polymer made of two polynucleotide chains that coil…
Q: If a person who was a regular cocaine user were to stop suddenly, do you think they would receive…
A: The continuous use of drugs like cocaine results in addiction and has a lot of side effects like…
Q: Exposure to test compounds for several days is commonly used to determine if they cause an…
A: Cell proliferation inhibition was estimated by MTT assay. The occurrence of apoptosis was evaluated…
Q: QUESTION 4 The main advantage of an established cell line versus a primary cell line prepared…
A: Centrifugation The technique by which different components of a mixture is separated.
Q: Explain about the TP53 Tumor-suppressor Gene ?
A: Genes are the main reason for hereditary in organisms or humans. These are present in the…
Q: QUESTION 13 13. How many minutes is an acceptable time for a centrifuge to spin blood specimens?…
A: Centrifugation The process of separating different molecules of different density in a solution by…
Q: What is the genotype of the following? Place the dominant (A) or recessive (a) allele on the "X"…
A: Introduction : In a living organism, passing on various traits from one generation to the next is…
Q: order to reduce the social and economic burden, therapeutic methods to ND, such as AD and PD, should…
A: The paragraph is all about the cause of various neuro degenerative disease and the treatment plan.…
Q: 15. Some molecules that are covalently bonded do not have a difference in charge across the mol-…
A: The research of biochemical functions at the cellular and molecular level is known as biochemistry.…
Q: what do you think is the coolest metabolic process for energy-producing nutrients?
A: All living organisms require energy for various living processes such as growth, reproduction,…
Q: 1. After mitotic cell division, each daughter cell must receive 3. Normal members of the some…
A: DNA is the deoxyribonucleic acid. It sis the genetic material of the cell and carries the…
Q: Col Using complete sentences, compare and contrast the terms living and biotic. In your response,…
A: Introduction Ecology is the study of interactions between living things, such as humans, and their…
Q: What exactly is the purpose of genetic foresight?
A: Introduction The study of genes and heredity together constitute genetics. It focuses on how…
Q: What is tissue inhibitors of metalloproteinases (TIMPs) ? How does it play an important role ?
A: Contact inhibition is the process by which cells stop growing when they come into contact with each…
Q: What are Human-Made Chemicals and Pollutants ?
A: A material that is present in concentrations that could be harmful to creatures (including people,…
Q: Drug A has a log P of -1.88 and Drug B has a log P of -1.09. Which drug would more easily dissolve…
A: Partition coefficient: It is defined as the ratio of the unionized drug distributed between the…
Q: People with a genetic condition known as Li–Fraumenisyndrome inherit one mutant copy of theTP53…
A: The gene controls the expression of various genes and also carries the code for different functional…
Q: Evidence supports that feathers evolved before flight, and were later co-opted for flight. This is…
A: Any net directional change or cumulative change in the characteristics of organisms or populations…
Q: Protein are the _________ of the cell. We need them to grown and heal but not to provide energy.
A: Proteins are biomolecules consisting of one or more long chains of amino acid residues.
Q: Explain about several clinical stages that arecharacterized by the stepwise accumulation of genetic…
A: Genetic defects are changes in the DNA that can be passed down from generation to generation. These…
Q: How do feedback mechanisms control the secretion of hormones?
A: Hormones are chemical messengers which are produced by the various glands in the human body and…
2c) If the whole potoroo genome is 4.2 x 10' bp, and the highly
repetitive DNA in the potoroo genome is composed entirely of
copies of the sequence 5'AAGACT' and its complement, how
many copies of this sequence are present in the potoroo
genome?
Step by step
Solved in 2 steps
- If the bandicoot genome is 3.62 x 109 base pairs, and the "highly repetitive DNA" fraction is composed entirely of copies of sequence 5'TGCGTGTGTGC3' and its complement, how many copies of this sequence are present in the bandicoot genome?Given the fact that 1 fg of DNA = 9.78 * 105base pairs (on average), you can convert the amount of DNA per cell to the lengthof DNA in numbers of base pairs. (a) Calculate the number of basepairs of DNA in the haploid yeast genome. Express your answer inmillions of base pairs (Mb), a standard unit for expressing genomesize. Show your work. (b) How many base pairs per minute weresynthesized during the S phase of these yeast cells?Although DNA transposons are abundant in the genomes of multicellular eukaryotes, class 1 elements usually make up the largest fraction of very large genomessuch as those from humans (~2500 Mb), maize (~2500Mb), and barley (~5000 Mb). Given what you knowabout class 1 and class 2 elements, what is it about theirdistinct mechanisms of transposition that would accountfor this consistent difference in abundance?
- 2b) If you denatured the random 1000 bp fragments of potoroo DNA by heating them to 95°C. and then cooled them down to 60°C and allowed them to reanneal, you would find that approximately 20% of the DNA fragments renatured very rapidly, another 30% of the DNAfragments renatured moderately rapidly, and the remaining DNA fragments renatured relatively slowly. From these results, whatfraction of the potoroo genome is composed of highly repetitiveDNA? helpful InformationGive two different reasons for the much higher ratioof total DNA to protein-encoding DNA in the humangenome as compared to bacterial genomes.A molecular biologist is investigating homologous recombination. One aim of this study is to reconstitute stages of the process in vitro. (a) Draw diagrams to show how the four synthetic oligonucleotides below could base-pair to form a stable model Holliday junction. W 5’ GATCGCATTGTAGCCGTAGGTCCACTGTAA 3’ X 5’ GTCCCATACGTAGCCGTAGGACATGTACCG 3’ Y 5’ CGGTACATGTCCTACGGCTACAATGCGATC 3’ Z 5’ TTACAGTGGACCTACGGCTACGTATGGGAC 3’ (b) What is branch migration? (c) What is the name of the enzyme that resolves a Holliday junction into two separate DNA duplexes? (d) On your diagram, indicate how the Holliday junction can be resolved in two different ways and draw the structures of the products.
- 3a)ClustalX software was used to perform multiple sequence alignment of thefollowing five Nco protein sequences designated as Nco1-Nco5 (the provided figure). A pair of degenerate primers was designed to PCR-amplify a DNA segment with the size of approximately 290 bp. With justification, discuss which amino acidsequence blocks would be suitable to design the forward and reverse degenerate primers.Although DNA transposons are abundant in the genomes of multicellular eukaryotes, class 1 elements usually make up the largest fraction of very large genomes such as those from humans (~2500 Mb), maize (~2500 Mb), and barley (~5000 Mb). Given what you know about class 1 and class 2 elements, what is it about their distinct mechanisms of transposition that would account for this consistent difference in abundance?In the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotides in the amino-acid-coding region is represented by the sequence: 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand? 4B. If the DNA duplex for the beta chain of haemoglobin above were transcribed from left to right, deduce the base sequence of the RNA in this coding region. 4C. In NOT more than 200 words, explain how eukaryotic RNA synthesized by RNA polymerase II is modified before leaving the nucleus?
- In the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotides in the amino-acid-coding region is represented by the sequence: 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand? 4B. If the DNA duplex for the beta chain of haemoglobin above were transcribed from left to right, deduce the base sequence of the RNA in this coding region.5’ TAAGCGTAACCCGCTAA CGTATGCGAAC GGGTCCTATTAACGCAC 3’ 3’ ATTCGCATTGGGCGATT GCATACGCTTG CCCAGGATAATTGCGTG 5’ Imagine that the double-stranded DNA molecule shown above was broken at the sites indicated by spaces in the sequence and that before the breaks were repaired the DNA fragment between the breaks was reversed. What would be the base sequence of the repaired molecule? Show the sequence, label the 5’ and 3’ ends and briefly explain the reasoning supporting your answerProvide a brief summary of the Sanger sequencing method.