3. Analyzing the Molecules of Life - Molecular Diagnostics An mRNA that encodes a variant of a human protein is as follows (the mutation is highlighted in red): CUUGUUAACAACUAAACGAACAAUCUUUGUUUUUCUUGUUUUAUUGCCACUAGUCUCUAG UCAGUGUGUUAAUCUUACAACCAGAACUCAAUUACCCCCUGCAUACACUAAUUCUUUCAC ACGUGGUGUUUAUUACCCUGACAAAGUUUUCAGAUCCUCAGUUUUACAUUCAACUCAGGA CUUGUUCUUACCUUUCUUUUCCAAUGUUACUUGGUUCCAUGCUAUACAUGUCUCUGGUAA RT-qPCR can be used to detect the variant (mutation). (a) In a few sentences or using a simple diagram/flowchart, describe the basic principle of RT-qPCR, and show the sequence of a DNA primer that can be used to reverse transcribe the entire RNA molecule as shown at 37 °C. (b) Design a pair of primers (DNA oligonucleotides) for detecting the mutation by qPCR. Assume that the PCR reaction will be performed at 72 °C. Show the sequences of your primers and their estimated Tm.

3. Analyzing the Molecules of Life - Molecular Diagnostics An mRNA that encodes a variant of a human protein is as follows (the mutation is highlighted in red): CUUGUUAACAACUAAACGAACAAUCUUUGUUUUUCUUGUUUUAUUGCCACUAGUCUCUAG UCAGUGUGUUAAUCUUACAACCAGAACUCAAUUACCCCCUGCAUACACUAAUUCUUUCAC ACGUGGUGUUUAUUACCCUGACAAAGUUUUCAGAUCCUCAGUUUUACAUUCAACUCAGGA CUUGUUCUUACCUUUCUUUUCCAAUGUUACUUGGUUCCAUGCUAUACAUGUCUCUGGUAA RT-qPCR can be used to detect the variant (mutation). (a) In a few sentences or using a simple diagram/flowchart, describe the basic principle of RT-qPCR, and show the sequence of a DNA primer that can be used to reverse transcribe the entire RNA molecule as shown at 37 °C. (b) Design a pair of primers (DNA oligonucleotides) for detecting the mutation by qPCR. Assume that the PCR reaction will be performed at 72 °C. Show the sequences of your primers and their estimated Tm.

Name: 3.Analyzing the Molecules of Life - Molecular DiagnosticsAn mRNA that
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 3.Analyzing the Molecules of Life - Molecular DiagnosticsAn mRNA that encodes a variant of a human protein is as follows (the mutation is highlighted in red):CUUGUUAACAACUAAACGAACAAUCUUUGUUUUUCUUGUUUUAUUGCCACUAGUCUCUAGUCAGUGUGUUAAUCUUACAACCAGAACUCAA

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1ITD: Below is a sequence of 540 bases from a genome. What information would you use to find the...

See similar textbooks

Similar questions

1. (a) What will be the newly synthesized DNA from the template given? DNA Template 3 - CGGATGCCCGTATAC -5 3 - GCCTACGGGCATATG -5 5 - GCCTACGGGCATAAG -3 5 - GCCTACGGGCATATG -3 3 - CGGATGCCCGTATAC -5 (b) Which is the DNA template given if the mRNA is 5 - CGGAUGCCCGUAUACGUA -3 ? 3 - GCCTACGGGCATATGGTA -5 5 - GCCTACGGGCATAAGGAT -3 5 - GCCTACGGGCATATGCAT -3 3 - CGGATGCCCGTATACCTA -5
GTTTTCACTGGCGAGCGTCATCTTCCTACT 1. Identify the gene from which the query sequence originates (Name of the gene)2. Provide the FULL protein sequence encoded by the gene.3. Are different splice variants known for this gene?4. What human disease has been connected to this gene?5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where theprotein carries no net electrical charge) of the protein.6. Provide the reference (in proper reference form: Author; Year; Title; JournalName; Volume; Page Numbers) for a recent publication involving the identifiedgene. This reference should NOT be a web page reference.7. Are there homologs for the identified gene in other systems? Identify one homolog in an invertebrate system (if there is none, provide a vertebratehomolog).8. What is the function (e.g. transcriptional regulation, transmembrane signaling,kinase, protease, etc.) of the protein(s) encoded by the gene.9. Generate a FULL protein sequence alignment for one of the…
Refer to the DNA sequence provided: 3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’ a. What is the mRNA transcript of the anticoding strand of the DNA model? b. What is the amino acid sequence of the polypeptide chain that will be translated from the mRNA in (a)?
Examine the following mRNA transcripts: Wild type: 5' CACUGAUGCACGGAUCAU 3' Mutant: 5' CACUGAUGCACGGAUGAU 3' What is the THIRD amino acid that will be translated in the wild-type sequence? SECOND BASE G. C. uGu-Cystelne (Cys) Uac UGA -Stop codon UGa -Tryptophan (Trp) UCU Ucc UAU UAC Tyrosine (Tyr) Phenylalanine (Phe) UUC. Serine (Ser) U UUA UuG UAA -Stop codon UAG -Stop codon UCA Leucine (Leu) Uca. CGu cac ccu CUU CUC CAU Histidine (His) Leucine (Leu) Proline (Pro) CAC Arginine (Arg) CUA CaA CCA ccG CAA Cua Glutamine (Gin) caa CAG ACU ACC AGU AUU AUC AAU Asparagine (Asn) Serine (Ser) Isoleucine (le) AAC AGC Threonine (Thr) AUA ACA AAA AGA Methionine (Met) Start codon ACC AAG -Lysine (Lyn) AGG Arginine (Arg) AUG - GcU GAU GUU GUC GUA GUG Aspartic acid (Asp) GAC GcC GCA aco Valine (Val) Alanine (Ala) -Glycine (Gly) GGA GAA GAG Glutamic acid (Glu) O Cysteine O Methionine O Histidine O Glycine FIRST BASE THIRD BASE
1. For the genotypes and conditions (lactose present or absent) shown in the following table predict whether functional enzymes, nonfunctional enzymes, or no enzymes are made. 2. Even though the LacZ,Y and A structural genes are transcribed as a single polycistronic mRNA, each gene contains the initiation and termination signals essential for translation. Predict what will happen when a cell growing in the presence of lactose contains a deletion of one nucleotide early in the Z gene and early in the A gene.
5 5 S 6 5 5 5 6 U 6 U 6 5:14 PM | 0.2KB/s HHHHH R R U RUUR ARU AP AP R U U R R AP R R R AP MOLECULAR...GENETICS. Describe gene regulation at transcription level. Explain the role of antsense RNA in control mechanism. Describe translational control mechanisms. Describe common DNA damages. Distinguish excision and mismatch repair. Describe the role of recA protein in recombination repair Elaborate on SOS repair mechanism. Define thymine dimer. How are they formed and repaired? Describe the molecular basis of mutation. 11 Leu+ Met+ Arg+ Write a detailed note on spontaneous mutation. Explain about mutant detection methods. Define reverse mutation. Describe the mechanism underlying Intragenic and intergenic suppressor mutations Describe the transposition mechanisms. 13 Vo LTE UNIT IV Time (Min) Describe the process of generalised transformation occurring in bacterial chromosome and plasmid. Elaborate on molecular mechanism and significance of transformation 22 Describe the process of…
1. (a) By binding one L-tryptophan molecule/monomer, the trp repressor binds to DNA to sup- press synthesis of L-tryptophan in E. coli. Below is the amino acid sequence of the helix - reverse turn - helix region of the trp repressor that binds to DNA compared to the sequence of the corresponding DNA binding motif of the Prl protein. A diagram of the trp repressor dimer is also shown. Trp Prl Trp Prl 80 -Gly-Glu-Met-Ser-Gln-Arg-Glu-Leu-Lys-Asn-Glu-Leu-Gly-Ala-Gly-Ile- -Ser-Glu-Glu-Ala-Lys-Glu-Glu-Leu-Ala-Lys-Lys-Cys-Gly-Ile-Thr-Val- trp helix 5 70 trp helix 4 Prl helix 80 Prl helix Ala-Thr-Ile-Thr-Arg-Gly-Ser-Asn-Ser-Leu-Lys-Ala-Ala- Ser-Gln-Val-Ser-Asn-Trp-Phe-Gly-Asn-Lys-Arg-Ile-Arg- reverse turn 90 Comparing the two protein sequences above, identify all amino acid pairs that differ in electrostatic charge due to proton dissociable groups (assume pH 7). Indicate the charge of both residues for each such pair. (b) Circle the pair of residues for which the electrostatic charge due to…
. A mutational lesion results in a sequence containing amismatched base pair:5′ AGCTGCCTT 3′3′ ACGATGGAA 5′CodonIf mismatch repair occurs in either direction, whichamino acids could be found at this site?
(11) If you design a gRNA with the sequence, GGU AUC AUU GCA CUG ACC AG, in theory which position of the nucleotide in the genomic DNA sequence below will be cut by Cas9 protein, which may lead to a knockout due to an error in DNA repair? The starting and the end coordinate positions of the DNA fragment on the chromosome are indicated at the beginning and end of the sequence, respectively. 110,001 ATC GGT ATC ATT GCA CTG ACC AGA GGC TAC 110,030 A) Between 110,023 (G) and 110,024 (A) B) Between 110,021 (C) and 110,022 (A) C) Between 110,020 (C) and 110,021 (C) D) Between 110,009 (C) and 110,010 (A)
E22. The method of Northern blotting is used to determine the amount and size of a particular RNA transcribed in a given cell type. Alternative splicing (discussed in Chapter 12) produces mRNAs of different lengths from the same gene. The Northern blot shown here was made using a DNA probe that is complementary to the MRNA encoded by a particular gene. The mRNA in lanes 1 through 4 was isolated from different cell types, and equal amounts of total cellular MRNA were added to each lane. 2 3 4 Lane 1: MRNA isolated from nerve cells Lane 2: MRNA isolated from kidney cells Lane 3: MRNA isolated from spleen cells Lane 4: MRNA isolated from muscle cells Explain these results. | |
Which of the following set(s) of primers a–d couldyou use to amplify the following target DNA sequence, which is part of the last protein-coding exonof the CFTR gene?5′ GGCTAAGATCTGAATTTTCCGAG ... TTGGGCAATAATGTAGCGCCTT 3′3′ CCGATTCTAGACTTAAAAGGCTC ... AACCCGTTATTACATCGCGGAA 5′a. 5′ GGAAAATTCAGATCTTAG 3′;5′ TGGGCAATAATGTAGCGC 3′b. 5′ GCTAAGATCTGAATTTTC 3′;3′ ACCCGTTATTACATCGCG 5′c. 3′ GATTCTAGACTTAAAGGC 5′;3′ ACCCGTTATTACATCGCG 5′d. 5′ GCTAAGATCTGAATTTTC 3′;5′ TGGGCAATAATGTAGCGC 3′
Examine the following mRNA transcripts: Wild type: 5' CACUGAUGCACGGAUCAU 3' Mutant: 5' CACUGAUGCACGGAUGAU 3' What kind of mutation is occurring in the mutant sequence compared to the wild type sequence? SECOND BASE Phenylalanine (Phe) UCU UAU Tyrosine (Tyr) UGU Cysteine (Cys) UUC UCc UAC UGC Serine (Ser) UAA -Stop codon UAG -Stop codon UGA -Stop codon uGa -Tryptophan (Trp) UUA UCA Leucine (Leu) UUG uca CUU CCU Cuc CAU CAC Histidine (His) CGU Leucine (Leu) Proline (Pro) C. CUA CuG Dainine (Arg) CCA cca CGA CAA CAG Glutamine (GIin) cGG AUU AUC ACU ACC ACA AAU AGU Isoleucine (lle) AAC Asparagine (Asn) AGC Serine (Ser) Threonine (Thr) AUA AAA Methionine (Met) Sta AGA AGG ACG AAG FLysine (Lys) Arginine (Arg) AUG - codon GUU Gcu Gcc GCA GAU GGU GUC GAc Aspartic acid (Asp) G. GUA Valine (Val) Alanine (Ala) Glycine (Gly) GAA GAG Glutamic acid (Glu) GGA GaG GUG aca O Silent O Missense O Nonsense O Frameshift FIRST BASE THIRD BASE