Answered: 4. Is there any situation in which DNA…

Name: 4. Is there any situation in which DNA is made based on a RNA templat
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 4. Is there any situation in which DNA is made based on a RNA template? If there is,explain with an example how it occurs and state the enzyme involved? 8. Describe the basic constituents of the cell membrane?

Science

Biology

4. Is there any situation in which DNA is made based on a RNA template? If there is, explain with an example how it occurs and state the enzyme involved?

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter12: Dna: The Carrier Of Genetic Information

Section12.3: Dna Replication

Problem 9LO: Discuss how enzymes proofread and repair errors in DNA.

See similar textbooks

Similar questions

1. Determine the effect of the following mutations on the DNA sequence. In each case, the mutation is described after the sequence (REFER TO THE SUPPLEMENTAL DOCUMENT FOR GUIDANCE TO THIS QUESTION). Adenine nucleotide (A shown in red below) was inserted into the DNA sequence at the position indicated by the arrow). Write out the sequence of the mutated DNA and the protein made from it. What is the effect of this mutation on the protein? (For example, how will the mutation affect the length and sequence of the protein? What about the function of the protein?) A 3' TACATGG'TTGTGCTAATT 5'
1. The image shown in Figure 1 below represents a strand of DNA following replication. The black lines present above the top and below bottom strands of DNA represent the phosphodiester backbone of the molecule. Examine the DNA strands and locate any sites that are damaged, mismatched, or otherwise require repair. Indicate where in the strand the specific lesion is located, and provide a detailed overview of the post-replicative repair process that would likely be used to rectify the lesion. Assume that each lesion, even those that are located in close proximity will be repaired separately. CH, CH, OCH, CH, OCH₂CH, GATCCGAATCGGCTAGGATCGGCATCCGATTCGATCGGCATCCGATCGCTAGCO CH, CH, CH, CH, CH, TACGATCGATC CTAGGATTA CCGACCCTAGCCGTAGGGTAACGTAGCCGTAGGCTAGCGACCGGGGATGCTAGCTAG Figure 1: Graphical Representation of a strand of dsDNA containing errors and damage following replication
1. Considering the following nucleotide sequence in an mRNA molecule: 5’ AUG UUA CGU AAU GCU GUC GAA UCU AUU UGC UUU ACA UAA 3' a) Write the sequence of the DNA template (antisense) strand from which the mRNA was synthesized. b) Write the sequence of the DNA coding (sense or informational) strand complementary to the template strand. c) Write the sequence of tRNA anticodon that corresponds to the given mRNA molecule. d) Write the amino acid sequence of the peptide synthesized from the given mRNA nucleotide sequence. e) Draw the structure of the pertide fragment made up of the first five (5) amino acids in the given polypeptide.
1). The sequence of mRNA made using the DNA double helix shown below is 2). The sequence of protein made using the mRNA is
4) Consider the following double-stranded DNA molecule: Complementary Strand: ATGTGTAGTGCGAGTTGA Template Strand: TACACATCACGCTCAACT a) What would be the amino acid sequence coded for by the template strand of the DNA molecule above?
Give the name of the enzyme that catalyzes each of the following reactions:(a) Makes a DNA strand from a DNA template. (b) Makes a DNA strand from an RNA template. (c) Makes an RNA strand from a DNA template
1. In a sample solution given for analysis; CATAGCTTTGTTAAA (DNA nucleotide chain). a) Show the 5 'and 3' ends by writing in triplet (codon) form. Find the number of Hydrogen bonds in the double helix DNA strand at the beginning. b) Find the peptide sequence that this DNA chain will synthesize and show the energy balance required for its synthesis and indicate its total load at physiological pH. c) How do you prove that this peptide sequence is as above? Explain.
1. Using the gel picture of the DNA ladder, show where your digestion of the paper cutting model showing cut fragments would appear. The linear uncut DNA is 640 base pairs in length. Insert an image below.
1. What are the differences between DNA and RNA? 2. Which process involves copying of DNA information from template strand and produces mRNA strand that will be used for protein synthesis? 3. Based on the activity, what is the function of anticodon(TRNA) on protein synthesis? 4. What causes mutation? Is it always harmful? 5. Does a simple change on DNA sequence affect the resulting protein? Explain briefly.
II. A double-stranded DNA molecule with the sequence shown below can produce a polypeptide that is four amino acids long. Identify which DNA strands are the coding and the transcribed template strands by circling C or T to the left of the table below, respectively. Use an arrow to indicate the direction of transcription. In the table, show the mRNA sequences and amino acids in this peptide. In spaces to the left and right of the table, label all 5' and 3' ends of all relevant nucleic acid strands. READ CAREFULLY: The table gives you the possibility of filling in answers that show transcription from either strand or in either direction. You are only required to fill in the information relevant to ONE PEPTIDE (no others). Refer to the genetic code on the following page. HINT: While we read and write in 2D from left to right, in the 3D world of a cell there is no such restriction on reading and writing associated with transcription or translation. AA mRNA TCA CGG AAT TTC TAG CAT GTA C or…
1. A region of DNA in a particular cell synthesizes a segment of RNA that is 174 bases long and in the form of a large palindrome. The RNA is transported to the cytoplasm and folds into a hairpin loop of double stranded RNA. In the cytoplasm, the hairpin loop is recognized by a double-stranded RNA cutting enzyme (dicer) and is cut into 21 BP lengths. When these 21 BP double stranded segments are combined with protein, they function by: Answer choices destroying specific mRNAs priming the synthesis of DNA sequences adding DNA to the chromosome ends (telomeres) acting as decoys for RNA degrading enzymes thus protecting the mRNAs present splicing the introns out of messenger RNA 2. The following are genotypes of merozygotes of E. coli with various combinations of lac operon mutations. Determine the phenotype with respect to beta-galactosidase (z), permease (y), and trans-acetylase (a) of each combination as U = uninducible, I = inducible, and C = constitutive. Choose from…
1. Regarding the triple DNA code, which of the following statements is true? • each DNA base encodes three amino acids • there are three genes encoding a protein • each amino acid is encoded by three DNA •bases each triplet encodes several amino acids