5. You are given three different substances that are known mutagens. Using a variety of techniques, you analyze the results of exposure to these substances. Your findings are shown in the table below. Using this data, match each of the three substances with one of the following molecular properties and explain your choice Molecular Properties I. One mutagen that looks like cytosine but forms a covalent bond with guanine II. One mutagen that can bind with either adenine or guanine III. A molecule that can insert itself between two base pairs in a DNA strand Substance Result of exposure A B C Increases the number of mutants that produce mRNA with AGA codons instead of AAA codons Significantly fewer viable colonies Increase in mutants containing frameshift mutations Substance Molecular Reason for choice property A B 8

5. You are given three different substances that are known mutagens. Using a variety of techniques, you analyze the results of exposure to these substances. Your findings are shown in the table below. Using this data, match each of the three substances with one of the following molecular properties and explain your choice Molecular Properties I. One mutagen that looks like cytosine but forms a covalent bond with guanine II. One mutagen that can bind with either adenine or guanine III. A molecule that can insert itself between two base pairs in a DNA strand Substance Result of exposure A B C Increases the number of mutants that produce mRNA with AGA codons instead of AAA codons Significantly fewer viable colonies Increase in mutants containing frameshift mutations Substance Molecular Reason for choice property A B 8

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1TYK

See similar textbooks

Similar questions

6. Mutation analysis of GCK gene in patients with diabetes revealed a c.114 TàA (shown in bold and underlined) substitution in heterozygote state. In order to check the mutation in healthy individuals, restriction enzyme analysis will be used. a) (5p) Which enzyme can we use to differentiate wild type and mutant sequence? Please indicate which allele (wild type or mutant allele) will be cut with the restriction enzyme. Use table 1 shown below. b) (10p) Draw the expected agarose gel result of a homozygous wild type, homozygous mutant and heterozygote individual after restriction enzyme analysis. ATGAGGCTCTTTGCCACCAGTCCCAGTTTTATGC ATGGCAGCTCTAATGACAGGATGGTCACCCCTG CTGAGGCCACTCCTGGTCACCATGACAACCACA GGCCCTCTCAGTATCACAGTAAGCCCTGGCAGG AGAATCCCCCACTCCACACCTGGCTGGAGCACG AAATGCCGAGCGGCGCCTGAGCCCCAGGGAAGC AGGCTAGGATGTGA Figure 1. GCK gene sequence. Length of the fragment is 213bp. Table1. The restriction enzymes and their recognition sequences. Restriction enzyme|Recognition sequence GG/CGCC Nar…
I. The DNA template, 3'–CGTTACCCGAGCOCGTACGATTAGG–5', was exposed to a mutagen, resulting in the following three templates. 2. A. 3'–CGTTACCCGAGCCGTAACGATTAGG-5' nserti on leuding to frame shift B. 3-CGTTACCCGATCCGTACGATTAGG–5' Point - Transversin C. 3'-CGTTACCCGAGCCGTTCGATTAGG–5' Transition I. Transcribe and translate each template and write down the primary sequence of the resulting polypeptide/protein. Describe how each of the mutations will affect the final protein product from the corresponding template. N met -gla - Ser- Ala -cys -Stup-d Predict whether gene expression (from initiation of transcription to final protein product) would be faster in a prokaryotic or eukaryotic cell. Explain your answer.
5. The nucleotide sequences of the DNA molecules in the figure below were obtained from four different individuals, one wild type and three mutants. Wild Type 5'-TTATCCATGATCGGATCGATCCATTAGCCGA-3' 3'-AATAGGTACTAGCCTAGCTAGGTAATCGGCT-5’ Mutant I 5'-ATCCATGATCGGATTGATCCATTAGCCGAAT-3’ 3'-TAGGTACTAGCCTAACTAGGTAATCGGCTTA-5’ Mutant II 5'-CCGTTATCCATGATCGGATAGATCCATTAGCC-3’ 3'-GGCAATAGGTACTAGCCTATCTAGGTAATCGG-5’ Mutant III 5'-CACCGTTATCCATGATCGGAACGATCCATTAGC-3’ 3'-CAGGCAATAGGTACTAGCCTTGCTAGGTAATCG-5’ a) Identify the open reading frames in each sequence of DNA and translate them into proteins. Write down the sequence of amino acids that will be obtained after translation: b) Which of the mutations above would be least likely to cause a change in the function of the protein? Why? c) Which of the mutations above would probably cause a major disruption in the function of the protein? Why?
1. You are working with a known chemical that can cause a mutation in the DNA. You decide to use the Replica Plating experiment to confirm that this is the case. Please talk about how this experiment works. Also, please discuss any two types of mutations that could take place due to this mutation and what these mutations can cause when DNA is made into protein. 2. What is a difference between prokaryotic and eukaryotic gene expression? Please explain. Also, discuss briefly the significance in splicing, why this is done and how this leads into variety of different polypeptides.
Below is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ 1.Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would this have on the protein? Look up an example for this type of mutation. 2, Assume the 5th and 6th amino acids are removed from the DNA template strand. What type of mutation is this? How would this affect the protein? Look up an example of this type of mutation. 3.Which mutation changes the protein more...a point mutation or a frameshift mutation. Explain your reasoning. 4.What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 5. What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this?…
3. Primer Design You are analyzing the region of DNA shown below to determine how many AATG repeats are present. To do so, you must amplify the entire region of AATG repeats. Design primers of 16 bases each so they anneal outside the region of interest. More than one primer pair is possible, but just give one. 51-АСTСGCАCGAACAGGCACTTAGGAATGAATGAАTGAATGAATGAАTGAATGACCTGтстссттсССАСТтсстСС-3' 3'-TGACCСтGтсттстссстGААТССТТАСТТАсТТАСТТАСТТАСТТАСТТАСТGGACACACCAAGGстСAAGGAGG-5' a. Primer 1: Primer 2:
9. The restriction site sequence for the restriction enzyme Sau3Al and BamHI include four identical bases, making their sticky ends identical as shown in the figure. Let's say you have foreign DNA whose flanking regions were cut with Sau3AI. Also, you want to use a plasmid containing a BamHI restriction site. (1) Would it be possible to ligate the foreign DNA into the BamHI site of the plasmid? Explain. lison Lenharc (2) Would it be possible to cut the ligated sites with Sau3AI? What about BamHI? What problems will you expect if you use BamHI? BamHI Sau3Al G-G-A-T-C-C பர்டிய C-C-T-A-G-G G-A-T-C Hi- 目1目 C-T-A-G C-C-T-A-G C-T-A-G G-A-T-C-C E E G-A-T-C= 10. An ampicillin-resistant, tetracycline-resistant plasmid, pBR322, is cut with Pstl, which cleaves within the ampi resistance gene. The cut plasmid is ligated with Pstl digested Drosophila DNA to prepare a genomic library, and t rcoli K12
7a. Given the following mutated sequence (with respect to the normal sequence), what TYPE of mutation occurred: AAGCCGTTAC 7b. Where did the mutation take place?
2. Dr. Kim at Research Center performed shotgun Sanger sequencing on an unknown DNA sample, and obtained the following reads (12 reads). Since the length of each read is quite short, Dr. Kim ran the original sample in a gel electrophoresis, and realized that the original DNA is just 50 base pairs long. (Please note that the resolution of gel electrophoresis is not so good. Thus, we cannot figure out the exact length of DNA using gel electrophoresis in the real world.) 2) AGCCG AGATG GCTG 4) CTGCA AGCCG A 1) САСТС ССAGT GTACC T 3) GGAGT CAATC GC 5) GGCTG TGCTT GG 7) GATGG CTGTG 9) CAGTG TACCT GCA 11) TGCAA GCCGA G 6) CTTGG AGTCA ATCGC 8) САСТС ССAG 10) GCTGT GСТTG G 12) TGCTT GGAGT (a) Find the sequence of the original DNA (reconstruction), and align each read with the reconstructed DNA sequence. (hint: put all reads on a ppt slide, and move them around to find overlaps.) (b) Calculate coverage at each nucleotide position of the reconstructed DNA, i.e., how many reads cover that…
2. Dr. Kim at Ewha Research Center performed shotgun Sanger sequencing on an unknown DNA sample, and obtained the following reads (12 reads). Since the length of each read is quite short, Dr. Kim ran the original sample in a gel electrophoresis, and realized that the original DNA is just 50 base pairs long. (Please note that the resolution of gel electrophoresis is not so good. Thus, we cannot figure out the exact length of DNA using gel electrophoresis in the real world.) 1) САСТС ССAGT GTACC T 3) GGAGT CAАТC GC 5) GGCTG TGCTT GG 7) GATGG CTGTG 9) CAGTG TACCT GCA 11) TGCAA GCGA G 2) AGCCG AGATG GCTG 4) CTGCA AGCCG A 6) CTTGG AGTCA ATCGC 8) САСТС ССAG 10) GCTGT GCTTG G 12) TGCTT GGAGT (a} Find the sequence of the original DNA (reconstruction), and align each read with the reconstructed DNA sequence. (hint: put all reads on a ppt slide, and move them around to find overlaps.) (b) Calculate coverage at each nucleotide position of the reconstructed DNA, i.e., how many reads cover that…
6a. Given the following mutated sequence (with respect to the normal sequence), what TYPE of mutation occurred: AAGCTTAC 6b. Where did the mutation take place?
1. The gel presented here shows the pattern of bands of fragments produced with several restriction enzymes. A N E Wells 8. 1 0.5 A = Aatl N= Ncol E= EcoRI (a) From your analysis of the pattern of bands on the gel, draw the correct restriction map and explain your reasoning. (b) The highlighted bands (magenta) in the gel hybridized with a probe for the gene pep during a Southern blot. Where in the gel is the pep gene located? Mark the area on the restriction map. < +Z 3. 2. Fragment size (kb)