A small section of MRNA codons has the following sequence: UGU GGU CAA CCG Some Amino Acids 1. Valine 2. Serine 3. Proline 4. Glycine 5. Arginine 6. Leucine 7. Histidine 8. Cysteine 9. Glutamine The amino acids listed above that are coded by the MRNA codons are , and Record your answer in order from left to right codons.

A small section of MRNA codons has the following sequence: UGU GGU CAA CCG Some Amino Acids 1. Valine 2. Serine 3. Proline 4. Glycine 5. Arginine 6. Leucine 7. Histidine 8. Cysteine 9. Glutamine The amino acids listed above that are coded by the MRNA codons are , and Record your answer in order from left to right codons.

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter13: Gene Expression

Section: Chapter Questions

Problem 4TYU: The genetic code is defined as a series of _______________ in _______________. (a) anticodons; tRNA...

See similar textbooks

Similar questions

Most codons specify an _________ . a. protein c. amino acid b. polypeptide d. mRNA
The genetic code is defined as a series of _______________ in _______________. (a) anticodons; tRNA (b) codons; DNA (c) anticodons; mRNA (d) codons; mRNA (e) codons and anticodons; rRNA
(ol soupe bannos96 SAM 3 A small strand of DNA has this sequence: 0pxbeter owl nade hoparg TACCGGAAACTG ATGGCCTTTGAC a. If the TOP strand is the template strand, what will be the mRNA made from this DNA read from left to right? What process allows for the mRNA to be made? b. If this is a eukaryotic mRNA, where does transcription occur? What would happen if the mRNA was not processed? c. What is the sequence of the protein made (use the genetic code below)? What process allows for the protein to be made?
Use the codon chart to determine the following RNA strand in amino acids (Remember to write it the same way the strand is): ACA-AGG-UUA-UGA second letter C A UAU Tyr U UUU UCU UGU Phe Cys UUC UCC UAC UGC C Ser UAA stop | UGA stop| A UAG stop UGG Trp UUA UCA UUG Le UCG CUU CCU CAU CGU His CUC ССС CAC CGC Leu Pro Arg CUA ССА САА CGA Gln СCG CAG CGG CUG AGU AAU Asn AUU ACU Ser AGC S AGA Arg AAC AUC } lle A AUA АСC Thr AAA Lys АСА AUG Met ACG AAG AGG GUU GCU GAU GGU Asp GAC GGC Gly GGA GCC GUC Val Ala GAA GAG } GUA GCA Glu GGG GUG GCG Your answer first letter ACUCAGUCAGUCAG third letter
5. Below is a segment of RNA, transcribed from a DNA sequence. Use the following codon chart to help answer the questions below. 5' AUG/CCU/ACG/GAC/UGG/CCU 3¹ First Letter U C A The genetic code Second Letter A U с G phenylalanine serine tyrosine cysteine phenylalanine serine tyrosine cysteine leucine serine stop G leucine leucine leucine leucine leucine serine proline isoleucine start/ stop histidine stop tryptophan arginine proline histidine arginine proline glutamine arginine proline glutamine arginine threonine asparagine serine isoleucine isoleucine threonine asparagine serine threonine lysine arginine threonine lysine arginine methionine valine valine valine valine a. What polypeptide would be generated by this sequence? alanine aspartate glycine alanine aspartate glycine alanine glutamate glycine alanine glutamate glycine Third Letter DUAGUUAGUUAG C с А UCAG b. The RNA is mutated to: 5' AUGCCCACGGACUGGCCU 3. What type of mutation has occurred? Show the new polypeptide chain. c.…
The following segment of DNA codes a protein. The uppercase letters represent Exons, the lowercase letters introns. Draw the pre- mRNA, the mature mRNA and translate the codons using the genetic code to form the protein. Identify the 5’UTR and 3UTR 5’- AGGAAATGAAATGCCAgaattgccggatgacGGTCAGCaatcgaGCACATTTGTGATTTACCGT-3’
3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Make vertical lines between codons to make this assignment easier to do. Which strand is the template strand? The first strand is the template strand as it going 3-5 Copy the template strand in mRNA. Label the 5’ and 3’ ends. 5' AUG UUA CCC GCU GCG CGA AGC AAA GUC UAA 3” Write out the amino acid (you can use the short form) that this protein would be made of (keep in mind proteins are usually a minimum of 50 proteins. Met-Leu-Pro-Ala-Ala-Arg-Ser-Lys-Val What do you notice about the mRNA strand compared to the non template strand of DNA? 2. What amino acid does the second codon code for on the DNA template strand? ______Assume the 6th amino acid in the strand is changed from a T to a C. What amino acid does it code for now? _______ What type of mutation is this? 3. Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would…
The name for the kind of point mutation/base substitution when a codon changes from CCC (which codes for proline) to CGC (which codes for arginine) is mutation. 2nd base in codon U CAG Cys Cys STOP STOP Trp Arg Arg Arg Arg Ser Ser Arg Arg Gly Gly Gly Gly Phe U Phe Leu Leu Ser Ser Ser Ser Tyr Tyr STOP Leu Leu Leu Leu Pro Pro Pro Pro His His Gln Gln C Asn Asn lle lle lle Met Thr Thr Thr Thr Ala Ala Ala Ala Lys Lys Asp Asp Glu Glu Val Val Val Val 3rd base in codon DCAGUCAGUCAGUCAG 1st base in codon
The mRNA codon of valine is GUC UGG CCA TTG
If DNA segments changes from GCATAG to GCATA, this is a: MRNA Codon/Amino Acid Chart First Base Second Base Third Base U A G 0001 Phenylalanine UCU UAU1 Tyrosine (Tyr) UAC UGUT FCcysteine (Cys) UGCJ U UUCJ (Phe) UCC Serine (Ser) UCA U UUA1 UAAT UGA - Stop A FLeucine (Leu) UUG- FStop UAG- UCG- UGG - Tryptophan (Trp) G CU- CCU CGUT CAU1 Histidine (His) CAC U CUC FLeucine (Leu) CUA CC Proline (Pro) CCA CGC FArginine (Arg) CGA CAA1 Glutamine A CAGI (Glu) CGG- CUG- CCG- G AUU AAU1 Asparagine ACU1 AGUT FSerine (Ser) AGC- AUC FIsoleucine (le) ACC Threonir AACJ (Asn) A AUA- ACA (Thr) AAA1 FLysine (Lys) AAG- AGA, FArginine (Arg) AGG- A Start Methionine (Met) ACG- AUG - GUU- GCU GAU- GGU | Aspartic Acid GAÇJ(Asp) U GỤC Valine (Val) GUA GCC FAlanine (Ala) GGC Glycine (Gly) GGA G GAA1 Glutamic Acid A GCA GCG- GAGJ (Glu) GGG- GUG- G
Table 1. The Genetic Code: Codons and Their Amino Acids First Two Nucleotides of Codons Last Nucleotide of Codons The Amino Acids A UU phe phe leu leu Abbreviations Names UC gly glycine ser ser ser ser UA tyr tyr term ala alanine term val valine UG cys cys term trp ile isoleucine leu leucine CU leu leu leu leu ser serine CC pro pro pro pro threonine proline aspartate glutamate lysine arginine thr CA his his gin gin pro asp glu lys CG arg arg arg arg AU le ile ile met AC thr thr thr thr arg asparagine glutamine cysteine methlonine asn AA lys lys asn asn gin AG ser ser arg arg cys met GU val val val val trp phe tryptophan phenylalanine tyrosine histidine GC ala ala ala ala tyr his GA asp asp glu glu GG gly gly gly gly term termination 3. Use Table 1 to read the codons below. Find the name of the amino acid and write it in the space provided. If the letters code for more than one amino acid, separate the names by dashes. b. UUA: c. GAG: d. UAUCUA: e. AUCUUG: f. AAGAGUUCG: g. AAAUUUGGG: h.…
The following is a section of a messenger RNA: 5' GACUACAUA 3' Look at the sequence carefully and using the following genetic code, translate the MRNA into an amino acid sequence. Second Letter U A G Phe uCu UC | Tyr UGU Cys u UUU U UUC UUA UUG UAU UAC UAA UAG UGC Stop UGA Stop A Stop UGG Trp G Ser UCA UCG Leu CAU CAC САА CAG CU CU His CGU U c Cuc CUA CUG Leu cc CCA CG CGC Arg CGA CG Pro Gin A 3rd G 1st letter AUU Ser u letter ACU lle ACC ACA AAU Asn AGU Thr AAC AAA A AUC AGC AUA AGA | Lys A Arg G AUG Met ACG AAG AGG Asp GUU G GUC GUA GCU GAU GAC GAA GGU GGC Gly Val |GCC GCA GCG Ala GGA GGG A Glu GUG GAG G O Tyr-Val-Val O Asp-Tyr-lle O Leu-Met-Tyr O lle-His-Gln O Asp-Thr-Leu-Tyr-Thr-His-lle 星