Algae and other phytoplankton are not abundant in aquatic communities. Species with identical niches do not coexist. Stable predator-prey relationships exist. There are more herbivores than there are carnivores. There are so many plants in terrestrial communities.

Q: (1) What does BLAST stand for? Explain the function of BLAST.

A: Information about bioinformatics is derived through computer analyses of biological data. In…

Q: In which portions of the upright test tube do Paramecium tend to aggregate. Explain. What is…

A: Single-celled protists known as paramecium or paramecia can be found in watery areas in the wild.…

Q: What is Chorioallantoic Membrane?

A: Developmental biology studies how integrating systems produce an organism's diverse dimensions,…

Q: O Biological O Phenetic O Phylogenetic O Parasympathetic 200 A-beaver Dam, AZ B-Twentynine Palms, CA…

A: Introduction Classification means the arrangement of various species into a groups. In the world…

Q: This type of cell transport does not require energy for the molecules to be transported. Passive…

A: Passive Transport Movement of molecules across cell membranes which requires no metabolic energy and…

Q: You’ve been noticing that a local pond has developed a green scum that is getting thicker and…

A: Since it frequently causes the degradation of water quality and the reduction of dissolved oxygen in…

Q: Lipoproteins like LDL and HDL transport lipids and proteins through the blood stream. Receptors on…

A: A lipoprotein is a biochemical assemblage whose main job is to move fat molecules in water that are…

Q: Energy from ATP

A: Energy from ATP  Primary active transport is also called direct active transport or uniport. It…

Q: give their taxonomic classification and describe their unique characteristics

A: Pocillopora damicornisis a genus of stony corals with inside the own circle of relatives…

Q: Which species requires the least amount of nutrients in order to grow: Lemna polyrhiza or Lemna…

A: Introduction: Small monocotyledons termed Lemna polyrhiza and Lemna gibba float on the surface of…

Q: Remove codons 24 to 66, inclusive AUGUUUGUACAUUUGUGUGGGAGUCACCUGGUUGAGGCGU

A: GENETIC CODE The genetic code is the relationship between the sequence of bases in DNA and the…

Q: The following are the conditions that determines the direction of ions as it pass through the…

A: The following are the conditions that determines the direction of ions as it pass through the…

Q: Is there any form of matter or energy that could never be considered pollution? Briefly compare and…

A: Our modern lifestyle renders us more susceptible to many illnesses. With increased pollution and bad…

Q: 4. What are some of the limitations of karyotyping? 5. Define trisomy. Define monosomy. 6. Define…

A: Genetics involves inheritance, characteristics, DNA, genes, proteins, and chromosomes. Everyone…

Q: A biotech company develops a biosensor that measures the presence of proteins activated by growth…

A: Introduction A biomolecule, sometimes known as a biological molecule, is any of the various…

Q: The following are the conditions that determines the direction of ions as it pass through the…

A: Ion Channel:  Ion channels are membrane proteins that produce pores in the membrane and permit ions…

Q: Calculate the total number of bacteria in your yogurt container three times (in duplicate). Begin by…

A: Colony forming unit:  A colony-forming unit is used to determine the number of viable microbial…

Q: In the potato osmosis lab experiment what is the point of having multiple potatoes soaking at each…

A: Answer: Osmosis : It is the process of movement or flow of water molecules across the membrane with…

Q: DNA: Why does histone modifications matter?

A: DNA ( Deoxyribonucleic acid ), is the genetic material of a cell. DNA is made up of repeating units…

Q: What are the similarities and differences between schistosoma ans taenia solium?

A: Taenia solium An organism that belongs to the group of playtyhelminthe. These organism are mostly…

Q: The is morphological difference between bipolar neurons and unipolar neurons and that determines how…

A: As you are reading this book, think about the organs that are functioning within you right now! Your…

Q: What evidences supported spontaneous generation? 2. How was spontaneous generation disproved?

A: Theory of spontaneous generation implies that different forms of organisms have formed on Earth from…

Q: 1a. What is the basic structure of a nucleosome? Also what's the key characteristics of histone…

A: Chromosome The highly condenced form of DNA chromatin fibres. These condensation is possible with…

Q: Antonie van Leeuwenhoek was the first person to use a microscope and describe tiny animalcules. What…

A: Introduction :  A microorganism is an organism too small to be seen by human naked eyes.…

Q: 1. In a tabular form, summarize your observations of the responses of Paramecium to various stimuli…

A: Paramecium or Paramoecium is a genus of unicellular ciliated protozoa. They are characterized…

Q: Define speciation and the role of genetic divergence among populations in creating new species.

A: Speciation is the emergence of new species in a given population. It creates reproductive isolation.…

Q: Name the physiological systems used to control the function of physically distant organs/tissues?…

A: Physiological system It is the system of our body that performs the major work like digestion,…

Q: . Distinguish taxis from a tropism. 2. What is thigmotaxis? Describe what happens when the…

A: Animals and plants are two distinct types of biological beings. As a result, the pathways that they…

Q: Which of the following would inhibit the function of the JAK-STAT Pathway? Multiple answers    A.…

A: JAK-STAT pathway is activated in response to cytokines (interferons and interleukins). The receptor…

Q: What is a fundamental niche?

A: The total collection of circumstances that allow an animal (population, species) to survive and…

Q: Lipoproteins like LDL and HDL transport lipids and proteins through the blood stream. Receptors on…

A: Lipoproteins like LDL (low density lipoprotein) and HDL (high density lipoprotein) are transported…

Q: Study the diagrams below. The diagrams represent four possible phylogenetic trees showing the…

A:

Q: Match the following: Gastrulation Organogenesis Blastula formation Formation of organs Gamete…

A: INTRODUCTION Gastrulation is a process in the early development of the embryo. The gastrula is…

Q: High levels of calcium ions in the blood cause increased secretion of calcitonin and increased…

A: Hormones are chemical messenger of our body which controls our body activities and hormones are made…

Q: Binding EGF to the EGF receptor causes phosphorylation of tyrosines on the cytoplasmic tail of the…

A: Tyrosine kinases are essential mediators of this sign transduction process, main to…

Q: The _____________ plants died, partially decomposed, and became the fossil fuels? (choose all that…

A: Sphagnum Moss:  There are over 380 recognised species of mosses in the genus Sphagnum, which is also…

Q: What are the limits to tree height and why?

A: The tree height is a tendency of the tree to become longer. Every tree tries to be as long as…

Q: Rehpogs are mythical creatures. They are small and not very smart. Rehpogs live on the ground in a…

A: Introduction Inheritance patterns are of different type’s   Mendelian inheritance, incomplete…

Q: If the DNA was replicated using the dispersive model, what would you have expected to observe in the…

A: 3 theories for DNA replication Conservative: According to this theory, the parent molecule is re…

Q: Illustrate simplified region (map) of the lac operon genes. Identify the genes present in this…

A: Lac operon is a control unit that consists of cluster of genes that helps in the metabolism of…

Q: Define cell. Enumerate the different classfication/types of cells and define each. What are the…

A: 1. Define cell.2. Enumerate the different classfication/types of cells and define each.3. What are…

Q: following method is employed in the sample preparation for the cryo-electron microscope? O The…

A: Cryo preservation is a process where organic matter is preserved at extremely cold temperatures. In…

Q: Choose one of the following scenarios. Describe the scenario. Describe the chain of events terms of…

A: Tonicity  It is the capability of cell to loose of gain water of the cell. The movement of water…

Q: Define and give an example of coevolution.

A: Evolution is the process of change in heritable traits of biological organisms over successive…

Q: what is bone marrow as an hematopoietic organ

A: Mesenchymal and hematopoietic stem cells are found in bone marrow. Red bone marrow is a fragile,…

Q: ANSWER THE QUESTION PROPERLY Question : Assuming you encountered an unknown microorganism, attempt…

A: Identification of any unknown microorganisms requires a pipeline of  different molecular and…

Q: What does “prezygotic” mean?

A: The processes of reproductive isolation are a group of behavioural patterns, physiological…

Q: Part of post a development of the genetically engineered foods (genetically modified organism or…

A: Although the methods to create a GMO plant are intricate, they generally go as follows: When a…

Q: Which of these substrate/enzyme pairs is correct? a. Lactose/cellulase b. Lipids/lipase c.…

A: The science of chemical reactions that take place within and relate to live beings is known as…

Q: The difference in charge and chemical concentration across a membrane is known as Membrane gradient…

A: Electrochemical gradient is The gradient is made up of two components: an electrical gradient and a…

Ecological adaptations

An ecological adaptation is any morphological, physiological, or behavioral trait of an organism that allows it to survive and reproduce in a habitat or ecosystem. Adaptation is a biological mechanism by which an organism gradually gets more acclimated to its surroundings.