Q: What would happen to the ecosystem services provided by a coral reef if it were to sustain permanent…
A: Numerous crucial services are offered by coral reefs to both the environment and people. They…
Q: Indicate what component (A to E) in the drawing corresponds to each of the following: Enhancers,…
A: By means of a process called DNA transcription, RNA polymerase rewrites the genetic data present in…
Q: A polyhistidine-tag or better known by its trademarked name His-tag is an amino acid motif present…
A: In vectors used to produce recombinant proteins, the DNA sequence defining a string of six to nine…
Q: Mary and her identical twin Jenny were told by their friends that even tho they are Identical twins…
A: DNA Deoxyribonucleic acid or DNA refers to a polymer that constitutes two polynucleotide chains that…
Q: 16. What is the relationship between an organism's DNA and protein? DNA determines which RNA…
A: Introduction Deoxyribonucleic acid is a polymer made of two polynucleotide chains that coil around…
Q: Differentiate among between Northern, Southern and Western blotting techniques.
A: Answer Difference between Northern , Southern and Western blotting is under : 1) Northern blotting…
Q: What is the major difference in the functions performed by the conventional PCR and real time PCR?…
A: PCR REAL TIME PCR A technique to amplify a segment of DNA , generating millions of copies of a DNA…
Q: The plasmids from the pUC series are created in the University of California. They carry a lacZ gene…
A: The pUC series plasmids have a lacZ gene that act as a selectable marker. The lacZ gene contains the…
Q: Which would be the control plate for the NaCl experiment and the Sucrose experiment and why?
A: Introduction:- control in an experiment usually set as a reference against which all other…
Q: Pineal body Arbor vitae lateral ventricle cerebellum 3rd ventricle corpus callosum optic chiasma…
A: It is critical to learn and know the anatomy and physiology of the body. Many changes in the animal…
Q: Discuss mechanisms by which cells communicate in short and long distances.
A: "Cells" communicate via their own chemical signaling system. Different chemicals, such as hormones…
Q: which of the following influences the bonding of oxygen to to hemoglobin? a) pH b) oxygen…
A: Hemoglobin molecule is the combination of a globin protein molecule and non-protein part heme and is…
Q: List the classification of fatty acids based on their chemical structures, as well as their…
A: Introduction :- The building blocks of fat in our bodies and the food we eat are called fatty acids.…
Q: 7. pane 9. Splee
A:
Q: Alterations in which of the following intracelluar pathways appear to be required for human cell…
A: <!--<SUB-PART>--> (a) <!--<SUMMARY-INTRODUCTION>--> To Determine: If the…
Q: Answer these questions in a You may include labeled drawings or tables, if helpful. Short answers,…
A: Countless trillions of chemical reactions take place daily in our bodies to support vital metabolic…
Q: Explain the mechanisms of the four types of fluorescence microscopy we discussed in lab: 1) GFP…
A: A fluorescence microscope is an optical microscope that studies the characteristics of organic or…
Q: 4. Which of the following are useful selectable markers (positive or negative)? A) A gene encoding…
A: The gene is defined as the sequence of nucleotides. It is present in DNA. It encodes a protein
Q: ____Synaptic potentiation ____ _________results when a presynaptic cell is stimulated repeatedly
A: Synaptic potentiation, synaptic potentiation results when a presynaptic cell is stimulated…
Q: A population of orange trees in a California town experienced a bottleneck. Which of the following…
A: Bottleneck effect severely limit the population size. This results in leaving only a small number of…
Q: 3. Why does intercellular spaces are absent in sclerenchyma tissues?
A: Tissue is a group of cells. These cells work together to perform specific function.
Q: Plant Histology Study Card 1 Bienn ©2014 Carolina Biological Supply Company Plant Histology Study…
A: Plant is a photosynthetic, eukaryotic structure, multicellular that belongs to plant Kingdom. Plant…
Q: Which enzyme is used for catalyzing the phosphorylation of glucose as well as the phosphorylation of…
A: Cellular respiration is a phenomenon in which glucose is used and of liberation of ATP takes place .…
Q: Species that have undergone higher rates of change (long-branched taxa) tend to be linked…
A: LBA (long branch attraction) is a type of error wherein the distinctly related species are shown as…
Q: How does volcanic activity change the environment? 4 sentences ,
A: The natural environment encompasses all living and non-living things occurring naturally, not…
Q: Which of the following types of mutations would be advantageous to a cancer cell (select all that…
A: Because negative regulatory proteins are eliminated when tumour suppressor genes are inactivated,…
Q: other diseases like Kwashiorkor Syndrome
A: Kwashiorkor: It is a condition which results from the inadequate protein intake. Initial symptoms…
Q: xplain how Protein Data Bank (PDB) can assist Dr.
A: protein data bank it enables science and education by providing access and tools for exploration,…
Q: glucagon is synthesized and secreted from the α-cells of the pancreas. Please describe how glucagon…
A: After the meals or in between the meals blood glucose levels tends to fall because of the continued…
Q: Cloning of a gene from the rubber tree can be carried out in bacterial cells. However, for the…
A: Cloning: It refers to the process of creating multiple identical copies of gene-sized pieces of DNA.…
Q: Which is the most important digestive enzyme in gastric juice?
A: Introduction The food you eat has to be broken down by digestive enzymes. These proteins hasten the…
Q: Anaphase A. Is the phase during which sister chromatids separate and move to opposite poles b.…
A: Mitosis is the division of a diploid (2n) mother cell and production of two diploid (2n) and…
Q: Use the following information to answer the next question. Stages of Mitosis (in Random Order) 1 g…
A: Please follow steps 2 & 3 for detailed explanation.
Q: Which numbers in the diagram represent where aerobic cellular respiration occur? 3 and 5 O2 and 3 2…
A: Respiration is basically metabolic process in which glucose is degraded and ATP is liberated. It is…
Q: Differentiate between the following terms used in medical epidemiology: 4.1. Sporadic vs endemic…
A: Sporadic refers to a disease that occurs infrequently and irregularly, it does not show any common…
Q: Suppose a couple produces 2 children with Prader Willi Syndrome. The older child (Taylor) has two…
A: Prader-Willi Syndrome and Angelman Syndrome are inheritable genetic disorders caused by gene…
Q: 26. What is the start codon and the corresponding amino acid for which it codes? FIISI DAS G UUU UUC…
A: The protein is synthesized by the translation process. The protein synthesis takes place in the…
Q: Describe the process of protein synthesis and trafficking of a protein, a lysosomal hydrolase,…
A: Introduction All cell membranes that exchange lipids and proteins are included in the endomembrane…
Q: Your supervisor, Dr. Bane, requests you to express a protein from rubber tree (Hevea brasiliensis).…
A: Numerous opportunities for the generation and isolation of heterologous proteins for research…
Q: 1) Describe the term "conditional lethal mutant" as it relates to rII mutants.
A: INTRODUCTION : r II mutants : Bacteriophage T4 is a virus which is responsible for infection in the…
Q: Calculate the number of grams needed to prepare 100 mL of a 0.20 M solution of cobalt sulfate…
A: 1 mole of a substance is equal to that substance's Molecular weight The molecular weight is cobalt…
Q: Red-green color blindness is inherited as a recessive X-linked trait. Individuals who are missing…
A: Colour blindness is a genetic disorder which is inherited as an X-linked recessive condition. It…
Q: Consider the figure attached, showing seven people studied between point A and B, and where the…
A: Prevalence of an illness = Number of people in the sample with illness/Total number of people in the…
Q: QUESTION 3 Given tubes of equal length and diameter (and the inflow/outfow pressures below), which…
A: Blood flow The local blood flow is the amount of blood that passes through any tissue in a specific…
Q: BasH II Kpnl Dra TTGTAAAACGACGGCCAGTGAGCGCGCGTAATACGACT…
A: Many people agree that one of the 20th century's most significant contributions to molecular biology…
Q: SDS-PAGE is a technique that allows you to do which of the following? Separate proteins based on…
A: Proteins are made up of amino acids that are bounded together by peptide bonds. Different proteins…
Q: Describe four different uses for thoracic appendages seen in different crustaceans. Use specific…
A: Crustaceans form a large, diverse arthropod taxon which includes animals such as decapods, seed…
Q: The principal genomic component isolated from equine influenza virus is 22% C, 23% A, 22% G and 33%…
A: Introduction Genetic material is the portion of a cell that contains the genetic information that…
Q: roblem 1 a) State the different requirements for a disinfectants b) State the advantages and…
A: Disinfection is process of the application of a chemical agent to destroy or inhibit the growth of…
Q: Consider the maternal effect gene that controls snail coiling where D = dextral, dominant, d =…
A: Shell coiling in snails can be dextral (coiling with the right hand) or sinistral (left hand…
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
An anticodon of tRNA has the sequence GCA. What amino acid does this tRNA carry?
HINT: you use mRNA codons to read the genetic code chart.
Step by step
Solved in 4 steps with 1 images
- Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?Use the codon chart to determine the following RNA strand in amino acids (Remember to write it the same way the strand is): ACA-AGG-UUA-UGA second letter C A UAU Tyr U UUU UCU UGU Phe Cys UUC UCC UAC UGC C Ser UAA stop | UGA stop| A UAG stop UGG Trp UUA UCA UUG Le UCG CUU CCU CAU CGU His CUC ССС CAC CGC Leu Pro Arg CUA ССА САА CGA Gln СCG CAG CGG CUG AGU AAU Asn AUU ACU Ser AGC S AGA Arg AAC AUC } lle A AUA АСC Thr AAA Lys АСА AUG Met ACG AAG AGG GUU GCU GAU GGU Asp GAC GGC Gly GGA GCC GUC Val Ala GAA GAG } GUA GCA Glu GGG GUG GCG Your answer first letter ACUCAGUCAGUCAG third letterRefer to the information on the genetic code. Use this information to determine how many amino acids are coded for by the mRNA sequence AUGCGCAGUCGGUAG. The genetic code Second letter of codon UAU UAC JUU Phenylalanine uCU UUC Phe) UUA Leucine (Leu) UUG Tyrosine (Tyr) GCysteine (Cys) UGC 1oStop codon |UGG Tryptophan (Trp) CGU CGC UcC Serine (Ser) UCA ucc CCU cC Proline (Pro) Stop codon UAG Stop codon CAU Histidine His) CU CUC CUA CUG Arginine (Arg) Leucine (Leu) cca CAA CCA CGA Glutamine (Gin) CAG AUU AUC AUA ACU Isoleucine (le) AAU AAC AGU AGC Asparagine (Asn) Serine (Ser) ACC Threonine (Thr) ACA Methicnine ACC start codon GCU Lysine (Lys) AGA Arginine (Arg) ARC AGS GAU Aspartic acid (Asp)G0 GAC GUU GUC Valine (Val) GCC Alanine (Ab) GG Glycine (Gly GUA GUG GCA GCG GA Glutamic acid (Glu) GA GGG GAG 4 15 First letter of codon Third letter of codon
- Indicate the amino acid sequence of the protein encoded by the following mRNA molecule. Use the genetic code table and assume that the very first “AUG” the ribosome encounters will serve as the start codon and specify methionine. 5’-AAUUCAUGCCCAAAUUUGGGGCACGAAGCUUCUUAGGCUAGUCCUAAAAAA-3’Use the genetic code table. Which amino acid is coded for by only one codon sequence? Second Position U A G UUU Phe /F UCU UAU UGU UUC Tyr/Y Cys/C UCC UAC UGC Ser /s UUA Leu /L UCA UAA STOP UGA STOP UUG UCG UAG STOP UGG CUU CCU CAU CGU CỤC His / H Leu /L CC САС Pro / P CGC CUA ССА Arg/R CAA CGA CUG Gln /Q CCG CAG CGG AUU ACU AAU AGU AUC le /i ACC Asn / N Ser /S Thr/T AAC AGC AUA ACA AAA AGA AUG Met / M ACG Lys/K Arg/R AAG AGG GUU GCU GAU GGU GUC Asp/ D G Val /v GCC Ala / A GAC GGC GUA GCA Gly/G GAA GGA GUG GCG Glu /E GAG GGG valine serine threonine isoleucine methionine MacBook PrO G Search or type URL +, #3 Third Position SCAG UCAGU CAGU CA First PositionFor the messenger RNA sequence below, find the beginning of the amino acid coding sequence and translate the sequence using the genetic code provided below. 5' - AAUUAUGGGCAAUAUGCCGGGCcGGUUAAGCG - 3' Second Letter A UGU cys u UGC Phe UCU UU U UUC UUA UAU Tyr Ser UAC UAA UAG Leu UCA Stop UGA Stop UUG UCG Stop UGG Trp CUU CU CAU His CGU c cuc Leu ccc ССА CCG Pro CÁC CAA CAG CGC CGA CGG Arg CUA CUG Gin 1st 3rd letter Ser u letter AUU ACU AAU AAC AAA AAG Asn A AUC AUA AUG lle ACC ACA AGU AGC AGA AGG Thr Lys Arg Met ACG GUU G GUC GUA GUG GCU GAU GAC GAA Asp GGU Val GCC Ala GGC Gly GCA GGA Glu GCG GAG GGG G
- Place sequences a, b and c into the correct order based on start and stop codons. Sequence ATCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGCCGCCAGGGCCCCGCCCCTCAGAAGTTGGTSequence B TCAGACGTTTTTGCCCCGTAACAACTTGTTACAACATGGTCATAAACGTCAGAGATGGTC AATCTCTTAATGACTSequence CTACAAACATGTAAACACACCCTCAGTGGACCAACTCCGCAACATAAACCAAACACCGCTC GCGCCGAAAAAGATATGGmRNA Codon Chart: Second letter с บบบ UCU UAU Phe UUC UCC U Ser UAC Tyr UGU UGC Cys UUA UCA Leu UAA Stop UGA Stop A UUG UCG UAG Stop UGG Trp CUU CCU CAU CGU CUC CCC His CAC Leu Pro CUA CCA CAA CGA Arg Gin CUG CCG CAG CGG AUU ACU AAU AUC lle ACC AAC AGU ]Asn Ser AGC A Thr AUA ACA AAA Lys AGA Arg AUG Met ACG AGG GUU GCU GAU GUC GCC Val GAC Asp GGU GGC Ala GUA GCA GUG GCG GAG GGG GAA Glu GGA Gly Amino Acid 3-Letter Codes Name of Amino Name of Amino 3-Letter Code 3-Letter Code Acid Acid Alanine Ala Leucine Leu Arginine Arg Lysine Lys Asparagine sex Methionine Met (start) Aspartic Acid Asp Phenylalanine ebe Cysteine Cve Proline Pro Glutamic Acid Glu Serine Ser Glutamine Gln Threonine Glycine GLK Tryptophan JAR Histidine His Tyrosine Tyr Isoleucine lle Valine Val Exercise: Transcription & Translation 1. Choose 3 DNA Templates. 2. Write the mRNA sequence divided into 3 letter codons. 3. Write the sequence of amino acids. 4. Find the corresponding amino acid sequence and include the letter of…FIRST BASE UUU- UUC UUA UUG U CUU- CUC -Phe -Leu DNA Sequence tRNA Sequence (anticodon) -Leu CUA CUG AUU- ACU AUC lle ACC AUA ACA Met or AUG Start ACG- GUU GUC GUA GUG mRNA Sequence (codon) AMINO ACID Sequence SECOND BASE C -Val UCU- UCC UCA UCG- CCU CCC CCA CCG GCU GCC GCA GCG Ser -Pro Thr Ala AAG GAU UAU Cys UAC UAA Stop UGA Stop UAG Stop UGG Trp CAU- CGU -His CAC CGC CAA CGA -Gin CAG CGG AAU- AGU- AAC- AGC AAA- AGA AGG GGU- ASP GGC GGA GGG GAC- GAA GAG UGU- Tyr UGC- Asn Lys G Glu Arg 2 1. In your bag is a specific DNA sequence. 2. Copy that sequence in the box below labeled DNA sequence 3. Transcribe the sequence in the appropriate box. 30 Ser 4. Determine the appropriate anticodon sequence. 5. Translate the appropriate sequence into an amino acid sequence using the codon chart above 6. Using the contents of the bag, create your protein. Arg Gly THIRD BASE
- If DNA segments changes from GCATAG to GCATA, this is a: MRNA Codon/Amino Acid Chart First Base Second Base Third Base U A G 0001 Phenylalanine UCU UAU1 Tyrosine (Tyr) UAC UGUT FCcysteine (Cys) UGCJ U UUCJ (Phe) UCC Serine (Ser) UCA U UUA1 UAAT UGA - Stop A FLeucine (Leu) UUG- FStop UAG- UCG- UGG - Tryptophan (Trp) G CU- CCU CGUT CAU1 Histidine (His) CAC U CUC FLeucine (Leu) CUA CC Proline (Pro) CCA CGC FArginine (Arg) CGA CAA1 Glutamine A CAGI (Glu) CGG- CUG- CCG- G AUU AAU1 Asparagine ACU1 AGUT FSerine (Ser) AGC- AUC FIsoleucine (le) ACC Threonir AACJ (Asn) A AUA- ACA (Thr) AAA1 FLysine (Lys) AAG- AGA, FArginine (Arg) AGG- A Start Methionine (Met) ACG- AUG - GUU- GCU GAU- GGU | Aspartic Acid GAÇJ(Asp) U GỤC Valine (Val) GUA GCC FAlanine (Ala) GGC Glycine (Gly) GGA G GAA1 Glutamic Acid A GCA GCG- GAGJ (Glu) GGG- GUG- GA segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: GGCTAGCTGCTTCCTTGGGGA CCGATCGACGAAGGAACCCCT Note out the mRNA sequence generated by the template strant to produce that polypeptide chain Label each stran with its correct polarity (5' and 3' ends on each strand)An mRNA transcript is listed below and contains both start and termination codons. Assume that the initial methionine will stay on the polypeptide in this case. What amino acid sequence will be specified during translation? List the amino acids. The start codon is highlighted. 5’ – CAGCCAAGCAUGCUCGCAAAUGGACGUUGAUAUUUUGUC – 3’