O AOBSpongesO CCnidariansOEBFlatwormAMulticellularityTAncostral protistFigure 23.1 One proposed evolutionary tree for animals.ईAnnelidsAMolluaksAt which branch in the accompanying figure did radial symmetry evolve?DRoundwormsArthropodsEchinodermaEChordatos

Body symmetry is the repetition of the body parts in an orderly fashion in an animal or plant.…

Answered: At which branch in the accompanying…

Science

Biology

At which branch in the accompanying figure did radial symmetry evolve? O A OB C OD ΟΕ

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter27: Introduction To Animal Diversity

Section: Chapter Questions

Problem 10RQ: Consulting the modern phylogenetic tree of animals, which of the following would not constitute a...

See similar textbooks

Related questions

Q: THE GENES A, B AND C ARE LINKED ON CHROMOSOME 2 OF S. CEREVISIAE. IN A SERIES OF TWO-POINT MAPPING…

A: In genetics, linkage refers to the tendency of genes on the same chromosome that are adjacent to…

Q: Where in messenger RNA does protein synthesis begin and end? Is there an amino acid that stops…

A: Protein synthesis is the biological process by which cells build proteins, which are essential for…

Q: Nitrogen fixation and nitrate assimilation are the only ways biological systems can incorporate…

A: Nitrogen fixation is the process by which atmospheric nitrogen gas (N2) is converted into a form of…

Q: are beta blockers contraindicated in patients with asthma and diabetes mellitus

A: When catecholamine such as epinephrine or norepinephrine binds to beta 1 and beta 2 receptors…

Q: sider this pedigree showing an autosomal dominant rare disorder. What is the ee of penetrance? Show…

A: Complete penetrance means that every person who has the mutation will show signs and symptoms of the…

Q: 5' AAGACCTATATAATGACGAACGATATT 3 TTCTGGATATATTACTGCTTGCTATAA 5¹ Coding strand: Template strand: 3'

A: Untranslated regions (UTRs) are extra sequences found in mRNA that are not translated. UTRs include…

Q: b. Suppose in 1,000 years the beetles from the sandy island come back into contact with the beetles…

A: Evolution is a naturally occurring phenomenon in nature by which all living forms tend to change by…

Q: Which of the following situations causes enlargement of the lymph nodes? Answers AC A: Accumulation…

A: Lymph nodes are small-bean-like structures that are found in large numbers clustered in various…

Q: Discuss the relationship between oxidation and reduction reactions and enzymes in the various…

A: Metabolic reactions are chemical reactions that occur within living cells, involving the conversion…

Q: Which of the following is a major cause of hepatocellular carcinoma? Select one: A. Liver cirrhosis…

A: Hepatocellular carcinoma (HCC) is a type of primary liver cancer that arises from the liver cells…

Q: Solution 1 Solution 2 M 16311 Solution 3 2.0 A 6. The following experiment was carried out at ILC…

A: Essential elements and nutrients are those that plants need to survive and complete their life…

Q: G.H. Hardy and Wilhelm Weinberg created the Hardy-Weinberg principle, which states that a population…

A: Evolution is the process of gradual change in the inherited traits of a population over successive…

Q: An F1 of the parents AABBCC x aabbcc was testcrossed to a triply recessive organism (aabbcc). AaBbC…

A: A gene is a unit of hereditary & functional part of the nucleic acid. Alleles are the…

Q: outline and describe the impact of Charles Lyell's work on the development of Charles Darwin's…

A: Charles Lyell was a geologist and a contemporary of Charles Darwin whose work on geology had a…

Q: Consider the two-line model of a gene below: A X A Y B 1 +1 If RNA polymerase is moving to the right…

A: Deoxyribonucleic acid, or DNA, is the genetic material found in humans and the majority of other…

Q: D Question 5 The main goal of utilizing the RNA-seq technique is to generate a: genome annotation.…

A: RNA sequencing (RNA-seq) is a high-throughput technique that is used to analyze the transcriptome of…

Q: In which of the stages of the mouse embryo do we find a cluster of pluripotent cells? O Four cell…

A: Pluripotency is the ability of a cell to develop into three Germ layers of the early stage.

Q: Answer choices for A: deletion, transversion, insertion, transition Answer choices for B: nonsense,…

A: In the given sequence, the translation starts from the mRNA sequence of the underlined part of the…

Q: Which of the following is a member of the Lepidosauria Group of answer choices Tuatara Turtle…

A: Lepidosauria is a monophyletic group of reptiles. Few common characteristics that are shared by all…

Q: 5) Proteins do not serve what function within the cell? a. structural support b. antibodies c.…

A: Proteins are polymers that are made up of monomeric amino acids. The two amino acids hydrolyse to…

Q: With respect to the Laws of Thermodynamics, what is the most important of the following roles of the…

A: Photolysis is a process that occurs during photosynthesis in plants and algae, which involves the…

Q: In an experiment that tested eye muscle reaction time based on a physical stimulus, 12 subjects were…

A: The amount of time it takes for the eye muscles to react to a visual stimulus is known as the eye…

Q: Describe the central dogma in depth.

A: The central dogma is a fundamental concept in molecular biology that describes the flow of genetic…

Q: The Petri Dish method is used in microbiology to raise bacteria in: a) rapid growth b) pure culture…

A: Petridish method is the growing or culturing the microorganisms in the petridish. It is easier to…

Q: An elderly is diagnosed with alzheimer's disease . Which of the following is most likely the…

A: ANSWER) Alzheimer's disease (AD) is a neurodegenerative disorder that affects the brain's cognitive…

Q: Which is the correct answer. I don't see it in your response.

A: The propagation of nerve impulses from one neuron to the next neuron occur at the synapse. The axon…

Q: What is the Anthropocene?

A: Geology is the fundamental Earth science that examines how the earth created and the various forces…

Q: ) Triglycerides make up the main form of lipid storage in: a. Plants b. Fungi c. Animals d. Mammals

A: A triglyceride is an ester derived from glycerol and fatty acids( three). Triglycerides acts as a…

Q: 11) A reaction occurs when water is added to separate two compounds. Dehydration b. Condensation C.…

A: When a substance do some chemical changes to produce a new substance which have entire new property,…

Q: Oligosaccharides are usually attached to proteins on loops or turns that project from the protein…

A: The interaction between proteins and sugar molecules, known as oligosaccharides, plays a vital role…

Q: what tests can you run doebthe diagnosis of Salmella typhi, and what is progression of the disease,…

A: The diagnosis of Salmonella typhi infection also known as typhoid fever can be made through several…

Q: Which of the following would NOT be characteristic of a single-source non-compromised STR profile?…

A: Short tandem repeat (STR) profiling is a technique used for DNA fingerprinting and identification.…

Q: Describe the epidemiological model for injuries and provide three examples of how energy causes…

A: The epidemiology of injuries is a branch of public health that focuses on the occurrence,…

Q: Which of the following is wrong for the description of protein synthesis (A) The large ribosomal…

A: Note: “Since you have posted multiple questions, we will provide the solution only to the first…

Q: . Your RNA sample has an absorbance of 0.350 at A260. The dilution for this reading was 1:20. What…

A: The RNA concentration in a sample is measured using the absorbance of the diluted sample when UV…

Q: 1.Explain the relationship between genotype and phenotype, and specifically describe the cellular…

A: The genotype of an organism refers to the genetic makeup or DNA sequence of the individual while the…

Q: d) What would happen if the majority of DNA between the enhancer and site of RNA pol binding was…

A: Gene expression is a multistep process involving replication, transcription, and translation as the…

Q: Is the concept of infectious dose applicable to Covid -19 infections? Why/Why not?

A: The "infectious dosage" is the quantity of a pathogen needed to cause an infection. It is improbable…

Q: Draw the two amino acids serine and alanine, and a dipeptide that could be formed by combining these…

A: Amino acids are the structural unit of proteins that contain an alpha carbon, an alpha-amino group,…

Q: 1which test is used to differentiate between fermentative and oxidative metabolism?describe the…

A: 1.The test used to differentiate between fermentative and oxidative metabolism is the…

Q: QUESTION 1 An individual with hypertrichosis has hair growing in areas of the body where hair does…

A: Hypertrichosis, also known as "werewolf syndrome," is a medical condition characterized by excessive…

Q: Oxygen was not always such a common molecule in the atmosphere as it is today. Explain how the waste…

A: Early in Earth's history, the atmosphere was primarily composed of carbon dioxide, water vapor, and…

Q: How could a change in the base sequence of a gene lead to a change in the phenotype of an organism?…

A: Gene expression begins with the process of transcription, in which DNA is translated into a single…

Q: Differentiate extraembryonic and intraembryonic coelom in terms of location in embryos. Provide…

A: Coelom It is defined as the main body cavity present in most organisms. It is the mesodermally lined…

Q: Search information on size birds: Little 1.finches 2. Parakeets

A: Birds It refers to a group of warm-blooded vertebrates that belong to the class Aves. These…

Q: Two genes in chromosome 7 of corn are identified by the recessive alleles gl (glossy), determining…

A: Recombination frequency is defined as the frequency of a single chromosomal crossover between two…

Q: i 2. Predict and explain the effect on GAL1 transcription, in the presence of galactose alone, of…

A: GAL1 transcription is the mechanism by which RNA polymerase II in eukaryotic cells converts the GAL1…

Q: A researcher performs a tissue transplant experiment with an early Drosophila embryo. The researcher…

A: One of the most crucial elements in ensuring the success of any organ transplantation is ensuring…

Q: Why is it not necessary to include a caloric content statement on the information panel

A: "Calorie" is defined as the "energy" of a food product. It is a unit of measurement that defines how…

Q: explain the steps for restriction and how each procedure of these three routes is performed in…

A: In rabbits, restriction refers to the administration of a drug or substance through various routes…

Concept explainers

Genetic Evolution

Sexual reproduction produces distinct population variations. Heredity determines the traits and qualities to be passed down to the progeny. Over time, this variation within-species is also affected by the process of human evolution. The study of how genetic variation leads to evolutionary changes is known as genetic evolution. If a trait helps an organism to survive and reproduce, it is more likely to be passed down the generations. It is rare that such traits result in a completely distinct set of traits in descendants than the ancestral population; this can result in the emergence of a new species.

Question

O A
OB
Sponges
O C
Cnidarians
OE
B
FlatwormA
Multicellularity
T
Ancostral protist
Figure 23.1 One proposed evolutionary tree for animals.
ई
Annelids
A
Molluaks
At which branch in the accompanying figure did radial symmetry evolve?
D
Roundworms
Arthropods
Echinoderma
E
Chordatos

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1: Introduction

VIEW

Step 2: Explanation for correct and incorrect options:

VIEW

Solution

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Extast Cyclostomes, whichincludes has fishesnd Lampreys, are theo dest lineage of vertebrates, which chaachteran co) difforentlates extat Cycbstre from extant cartildaginaus Aish (chandraichlyns)? Lyclostomes lack Jaws Cycbstomes haye cartlaginous, skeletons Darsal and ventral fAns absent from Cyclostones Cyclostones lack a Vertebrad Colum Cyclostames have mineralization of Skelehms
Amnotes ar tehapads Hhat have terrestraly adapled anneie eggs, ofamble which strachrese eggs potet the embryoof reptiles and birds from dessication? Allerb's shell Chorlos Anno Albumen Yok sac Litinl velority of the particle is v(0) = 3, find
F2 @ W 3 Which of the following things is/are true about this organism? O Phylum Chrodata MacBook Air F6 E Subphylum Vertebrata Echinoderm Odorsal tubular nerve cord Ofish lancelet Ohas a notochord 80 à Kingdom Animalia $ 4 R % T 6 & 7 F7 * CO 8 DII FB ( 9 F9 FL
What type of body symmetry does this creature have? O none - asymmetrical O ribbitical O radial bilateral.
25. See Fig. 32.11 A phylogeny of living animals. Draw a phylogenetic tree that includes all of the following groups. There are about 36 phyla of animals. Do NOT include those groups not listed here. ancestral protists platyhelminthes molluscs sponges cnidaria annelids echinoderms nematodes chordates arthropods Add the following clade names to the tree where appropriate: Metazoa Deuterostomia Eumetazoa Lophotrochozoa Ecdysozoa Bilateria
able 11.1. Comparison of some representative specimens of cnidarians. Genera Observable stage (medusa, polyp or both) Other distinctive characteristics (solitary or colonial; symmetry; with or wlo deposits) Acropora Aurelia Fungia Hydra Table 11.2. Comparison of the main body regions and appendages of arthropods. Class Body Regions Attached appendages based on body regions Diplopoda Chilopoda Insecta Arachnida XISMATER
3 (8.B) A student collected the animal shown below on a field trip. The student used a dichotomous key and a microscope to classify the animal. Step Characteristic Identification Go to 2 la Possesses segmentation 1b Lacks segmentation 2a Has an exoskeleton with jointed appendages Has no exoskeleton, unjointed appendages (if any present), and a segmented worm- Go to 3 Phylum Arthropoda 2b Phylum Annelida like body; is possibly in a tube (if in a tube, may have tentacles) Possesses a foot, a radula, arms, and/or За a shell Phylum Mollusca Lacks all of the above and is dorsoventrally 3b Phylum Platyhelminthes flattened How should this animal be classified? A Arthropoda C Mollusca B Annelida D Platyhelminthes silominA istockphoto.com/Nancy Nehring
luishing Characteristics of Invertebrates 1. Read the following riddles about the common invertebrates found in your locality. 2. Complete the table with the needed details. Riddle Animal Classification Description 1. It lives in the ocean. It likes to eat crabs. Its eight legs are called tentacles. 2. It is unsegmented body. It has a tail and a head end. It commonly lives humans. 3. It lives in the sea but itis not a fish. It has five arms covered with spiny skin on top. 4. It can be found in the branches of trees and in the house. It spins silk a flatworm with long on which can be used for capturing its prey. 5. It is a round worm which lives in the small intestine of humans. It can cause intestinal disease. 6. It does not bite nor sting. It has compound eyes. diseases. It can spread 7. It has an elongated body with one pair of legs per body It can inflict pain by segment. injecting its venom. 8. It burrows underground through the soil and brings subsoil closer to the surface. It…
can someone make me some brochure in canvathe topic is to make a brochure that represents Porifera, Coelenterata, Platyhelminthes, Aschelminthes, Annelida, Arthropoda, Mollusca, Echinodermata, Chordata. under phylum of animalia
ABCDEF GH 1 Echinoderm phylum A Verts that can lay E "Gnathostomes" = shelled eggs or have placenta. Clade called the: vertebrates with what? 2 Chordate 8 Verts with four F Subphylum limbs, a clade called consisting of what animals? the: Chordate 9. C Verts that can subphylum breathe air consisting of what animals? Chordates that clade formerly used only for bony fish; 4 10 Phylum Chordata all of makes lots of slime: whom have at least now used for all the following 4 verts with bone: features: Verts that latch 11 onto other animals as ectoparasites:
Bilateral symmetry is a(n) A B C O synapomorphic O ancestral claws O derived O analogous * trait for the species on this tree D E F wings exoskeleton hair + bilateral symmetry G H four limbs vertebrae wings scales 2 pts
Having _______ is a synapomorphy of bilaterians. collagen the ability to move a notochord 3 germ layers