Below are fragments from a shotgun sequencing run of a single chromosome. On a separate piece of paper, align the four sequences as best you can using nucleotide overlaps. NOTE: an overlap of only 1 nucleotide is not considered sufficient for building an alignment. How many contigs are represented by these sequences, onc aligned? 5'TGGAATTTCA 5'GTGGAATT 5'AGTGG 5'GCATGCA 4
Q: stion 10. Which test examines carbon utilization? GEL TDA
A: Carbon utilization is a broad term used to describe the many different ways that captured carbon…
Q: 2012 12 Van Meth Control Amp Fig. 1 Result showing the effect of different antibiotic on the growth…
A: Antibiotic Sensitivity Test is a test used to determine the efficacy of certain antimicrobial agents…
Q: esplain in defail the to ans lafionel and explain the seole Codon in the
A: The translation of the nucleotide sequence of an RNA molecule into a polypeptide chain is a complex…
Q: Calculate the number of phosphates, deoxyribose and ribose, and nitrogenous bases needed for DNA and…
A: Nucleotide Organic molecule with a basic composition of a nitrogenous base, pentose sugar and…
Q: Write an equation to describe the catabolism of an aerobic hydrogen oxidizer 20. Tell me as much as…
A: Many organisms are capable of using hydrogen (H2) as a source of energy. While there are several…
Q: Answer the following questions given the pedigree below. Please assume that no other mutations are…
A: Pedigree is a family chart showing the inheritance of a particular traits through several…
Q: Autoimmunity produces reactions that resemble which of the following hypersensitivity reactions?…
A: Immunity is the ability of multicellular living beings to oppose destructive microorganisms.…
Q: What is the mode of action for kanamycin? Is it bacteriostatic or bactericidal?
A: Antibiotics are the substance or medicines that either kill the bacteria or cease the growth of…
Q: The smallest unit that evolution act upon is
A: According to the Theory of Evolution given by Charles Darwin, evolution occurs through natural…
Q: For the statements below tell which from the list below applies 1. meiosis 2. mitosis 3. neither…
A: Cell division is a process by which new cells are formed.
Q: The pedigree below shows that inheritance of a disease that is caused by a late onset, dominant,…
A: * Given that pedigree shows that inheritance of a disease caused by late onset and it is dominant…
Q: What are the two ways in each X ray cause damage
A: An x ray is a penetrating form of high-energy electromagnetic radiation. Radiation can cause damage…
Q: 6. Activated charcoal is used: A. Internally in poisonings. B. Locally in damaged skin. C. Locally…
A: Activated charcoal is made by heating charcoal in the presence of a gas. Charcoal is amorphous…
Q: In peas, yellow pods are dominant to green pods. Show the results of a cross between a pure yellow…
A: Dominant trait is the one which is expressed even in presence of a recessive trait whereas a…
Q: What are the various public health measures, which you would suggest as safeguard against infectious…
A: Prevention of infectious diseases through health-promoting measures The following are examples of…
Q: Albright syndrome is caused by a mutation in a gene that is imprinted. A is the wild-type allele and…
A: Given: A pedigree. Albright syndrome is caused by a mutation in a gene that is imprinted. A - Wild…
Q: If a Mendel's dihybrid cross between two double heterogotes (AaBb x AaBb), assuming that the…
A: Dihybrid cross portrays a mating test between two life forms that are identically hybrid breed for…
Q: Define the concept of natural selection in your ownwords, and explain how it follows logically from…
A: A change in the genetic makeup of a subgroup, or population, of a species, is referred to as…
Q: 1. List the pathway that light takes to the brain by putting the following structures in order:…
A: Our eyes are sense organs for vision. They also help in perception of colour. Human beings have to…
Q: Match the process with the correct phase of the cell cycle (G1, S, G2, M). If the process occurs in…
A: Cell cycle is a complex process with Many steps controlled by enzymes and various factors such as…
Q: THE FAT CAT SAT" is the original strand, if it turns to " THE EFA TCA TSA T" what type of mutation?…
A: *NOTE: Kindly repost for other questions. Dear Student as per the guidelines we are supposed to…
Q: Remains of organisms are examples of evidences that paleontologists use in studying evolution. How…
A: The preserved remains of organisms whose bodies were buried in sediments, such as sand and mud,…
Q: What is pedigree analysis? Suggest how such an analysis, can be useful.
A: Pedigree analysis is a chart that represents a family tree, which displays the members of the family…
Q: Answer the following questions given the pedigree below. Please assume that no other mutations are…
A: Pedigree is a family chart showing the inheritance of a particular trait through Several generations…
Q: This theory states that organisms with desirable characteristics may survive while those with weaker…
A: According to the guidelines multiple questions need to be submitted separately. The first one is…
Q: How could you use ChIP-Seq to inform your design of guide RNA?
A: ChIP- seq stands for chromatin immunoprecipitation sequencing and contains a combination of ChIP…
Q: Describe when inflammation is good and when it is bad. What are the five hallmarks of inflammation?…
A: Introduction Inflammation:- It is a process When your body encounters an offending agent (like…
Q: Sample of designer GMO and answer the ff questions 1. What is the name of your “designer GMO”? 2.…
A: GMO It means Genetically Modified Organism. These organisms have their genetic material manipulated…
Q: Briefly Define Compounding Area of pharmaceutical industry? Write by your own sentences and thoughts…
A: Introduction Compounding Areas of the pharmaceutical industry perform the process of combining,…
Q: A patient with Essential thrombocythemia was extracted for CBC to monitor the effectiveness of…
A: A low platelet count can be a result of the body destroying too many platelets too quickly. Some…
Q: multiple codons (genetic code triplets)
A: Answer Multiple codons can code for the same amino acid. The codons are written 5' to 3', as they…
Q: PROBLEM 20 UAA is a stop codon. Why does the UAA sequence in mRNA in Problem 18 not cause pro- tein…
A: The enzyme RNA polymerase utilizes the DNA as a template to generate pre-mRNA transcripts during…
Q: Snow geese (Chen caerulescens) come in two color types, white “snows” and “blues” with dark bodies.…
A: Snow geese (Chen caerulescens) shows two color types, white and blue (dark). This color type is…
Q: Rabies is a disease that can be transmitted between humans and animals. describe at least two human…
A: Rabies can be described as the viral diseases of dogs and other animals that spread to humans…
Q: What stucture of Bacillus anthracis makes it capable of surviving in powered form and natural soil,…
A: * Bascillus anthracis ia a bacteria that is rod shaped and causes anthrax disease to livestocks. *…
Q: Action potential ente from adjacent cell. 1 Ca2+ 2 K* 3 Na* Ca2+ ЕCF ATP NCX ICF 3 Na* RyR Ca2+…
A: The muscle contraction of myocardial cells is activated with the help of specific stimulus that…
Q: QUESTION 9 Under what circumstances does a one male polygynous group become a multi-male polygynous…
A: The theory of evolution, like other hypotheses, is based on actual data as well as the reasoning for…
Q: What substance is produce by a microorganism that is capable of the inhibiting the growth of other…
A: Introduction Microorganisms are an organism that can be seen only through a microscope.…
Q: a 5-carbon sugar. O histones. a phosphate group. O a nitrogen base.
A: DISCLAIMER As per the guildlines, you have asked multiple questions, we will solve the first…
Q: What is pedigree analysis? Suggest how such an analysis, can be useful.
A: Introduction In this question we will discuss about the pedigree analysis.
Q: In a food chain or food web, arrows point ... O from predator to prey O from prey to predator
A: Introduction Ecosystem is the fundamental unit of ecology where biotic factor interacts with their…
Q: in the figure, determine what is the schlerenchyma cells?
A: Dicotyledonous Stem . Transverse section through a Dicot stem shows the following features . Outer…
Q: Explain the Law of Dominance using a monohybrid cross.
A: Introduction In this question we will explain the Law of Dominance using a monohybrid cross.
Q: Hominin evolution up to the point of AMHs occurred during a period of the Earth’s history when the…
A: Hominin species were changing over times of a huge number of years, adjusting to new environmental…
Q: Differentiate HbA1c from Fructosamine. Give 3 comparisons
A: HbA1c- it is the hemoglobin test which measures the amount of sugar in the blood which is attached…
Q: What are the best organism and nutritional type match? A. Uses inorganic chemicals for energy and an…
A: Cyanobacteria: is also known as blue-green algae that prefer to live in moist and aquatic…
Q: 9. The treatment for heatstroke is to A. Reduce the body temperature as quickly as possible B.…
A: Introduction Heatstroke:- Heatstroke is the most serious heat-related illness, it is a…
Q: When comparing two multivitamins in the store, you see that one has 500% of the daily value for a…
A: The Daily Values are reference amounts that are expressed in g, mg, or micrograms of nutrients to…
Q: 2. In Pasteur's vaccination experiment with chicken cholera, why was it important that the bacteria…
A: A vaccination works by conditioning the immune system to detect and attack infections, which can be…
12
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- Below are 9 possible primer pairs.● Determine which primer pair is the best choice.● Explain why the other primers are not good choices.● Calculate the Tm for each primer. Underline or highlight the region of DNA for the primer pair you chose as the best.Forward 1: 5’ gaaataattttgtttaactttaag 3’ Tm =Reverse 1: 5’ gtttaagacaaaatagtctgg 3’ Tm =Forward 2: 5’ gtaactcagctttcaggtcg 3’ Tm =Reverse 2: 5’ tctcggaatgttgcaacagc 3’ Tm =Forward 3: 5’ agattagcggatcctacctg 3’ Tm =Reverse 3: 5’ atgtgtaatcccagcagcag 3’ Tm =Forward 4: 5’ cattgattatttgcacggcg 3’ Tm =Reverse 4: 5’ aaaatcttctctcatccgcc 3’ Tm =Forward 5: 5’ tccataagattagcggatcc 3’ Tm =Reverse 5: 5’ tgcaagcttggctgttttgg 3’ Tm =Forward 6: 5’ gatcctacctgacgcttttta 3’ Tm=Reverse 6: 5’ aaataatgaattcgagctcggt 3’ Tm =Forward 7: 5’ataaaaaaatcgagataaccgtt 3’ Tm =Reverse 7: 5’aggtcgactctagaggatc 3’ Tm =Forward 8: 5’ctacctgttccatggccaac 3’ Tm=Reverse 8: 5’ ttcgggcatggcactcttg 3’ Tm=Forward 9: 5’ tccataagattagcggatcc 3’ Tm =Reverse 9: 5’…In a genome project, the following genomic DNA sequences were obtained. Assemble the sequences into a contig. Using the assembled sequence, perform a BLASTn search. Does the search produce sequences similar to your assembled sequence? 5’ TCGGGGTCCTGGGATCTCATCACTGCAGCGC 3’ 5’ACTGCAGCGCTTTCCCAGCGGGCGGTGGTAC 3’ 5’GGGCGGTGGTACTCGGGAAGTCAGGAGTGTT 3’ 5’AGGAGTGTTTAAAACCTGGGGACTGGTTTTG 3’ 5’TGGTTTTGGGGGCGCTGAAGGCAGCGCAGGA 3’There are numerous methods for sequencing DNA, including classical Sanger sequencing, automated Sanger sequencing, and next-generation sequencing technologies, including Illumina technology. Match the modified cytidine nucleotide triphosphates (NTPs) with DNA sequencing methods that utilize them. Classical Sanger sequencing HO-P=O O HO-P=O O HO-P=O O Automated Sanger sequencing -NH₂ CH3 H₂CN ° ? ?N HOOOO OH OH OH NH CH₂ Next-generation DNA sequencing (Illumina) CH₂ NH₂ Answer Bank
- In the following gel showing stained bands of the Alu insertion sequence, what is the genotype of individual 2? 941 bp 641 bp->>> 1 2 3 4 5 6 Homozygous for the 641 bp sequence that does not contain in the Alu insertion Heterozygous, containing one 941 bp sequence and one 641 bp sequence O Homozygous for the 941 bp sequence containing the Alu insertionDesign a pair of primers to amplify the entire length of the following 45 base pair sequence.Make each primer 14 bases long. Write the sequences of the primers in 5' to 3' order.(Hint: It will help for you to write out BOTH strands of the DNA sequence listed below.5'-GATGCCCGTTGGATAAATTGGGCGTCTAGAATCGGTCACACTTAG-3'If you had the RNA sequence below: 5'UUUGGAG 3' and you were going to make a piece of DNA that would be a complement to it, what would the DNA sequence be? 5' 3' What 12-nucleotide primer would you use in the PCR technique when you want to amplify a gene whose end is as follows: 3' CGGCTCGACAAGGTG5' ? 5' 3'
- For the following short sequence of double stranded DNA and the given primers, there will be one major duplex DNA product after many cycles (imagine 10 cycles) of PCR. Provide the sequence of this one major duplex product and label the 5’ and 3’ ends of each strand. Sequence to be amplified: 5’- GGTATTGGCTACTTACTGGCATCG- 3’ 3’- CCATAACCGATGAATGACCGTAGC- 5’ Primers: 5’-TGGC-3’ and 5’-TGCC-3’In a standard procedire, when writing and reading base sequences for nucleic acids (both DNA and RNAs) always to specify base sequence in 5' > 3' direction unless otherwise directed 1. From the base sequence 5' A-T-G-C-C-A 3' in a DNA template strand, determine the base sequence in hnRNA synthesized from the DNA template strand 2. From the base sequence 5' T-A-A- C-C-T 3' in a DNA template strand, determine the base sequence in hnRNA synthesized from the DNA template strandTable I CACGT A GA CTGAGG ACTC CACGTAGACTGAG G ACAC Wild-type beta-globin gene fragment Sickle-cell beta-globin gene fragment > Circle the mutation in DNA of the sickle-cell beta-globin gene fragment Compare fragments of DNA the wild-type and mutant beta-globin genes in the Table I above, what are the similarities and differences you observe?
- Using the first and second base key below, predict the DNA sequence given by the SOLID color sequence. For the key G = green, R = red, Y = yellow, and B = blue. Note that the first base of the sequence is already given ("A"). Give the remaining 8 bases for this sequence. A First base A CCT Second base A CGT BGY R GBRY RBG R Y (G) B Y G)(R) GB )( R )( Y ) ( G) BWhat is the role of di-deoxy DNTPs in a Sanger sequencing reaction? Please select the answer that is most correct. The di-deoxy DNTPs are incorporated into the growing DNA molecule. The di-deoxy DNTPs terminate polymerisation of the growing DNA molecule, thereby creating fragments which all end in that specific di-deoxy base. Subsequent separation of the fragments by size facilitates the ascertainment of the sequence. The di-deoxy DNTPs facilitate polymerisation of the growing DNA molecule. this allows for multiple copies fo the template to be made for further analysis. The di-deoxy DNTPs terminate polymerisation of the growing DNA molecule. Ending the replication ensures that the molecules are not too long to be sequenced.A molecular biologist is investigating homologous recombination. One aim of this study is to reconstitute stages of the process in vitro. (a) Draw diagrams to show how the four synthetic oligonucleotides below could base-pair to form a stable model Holliday junction. W 5’ GATCGCATTGTAGCCGTAGGTCCACTGTAA 3’ X 5’ GTCCCATACGTAGCCGTAGGACATGTACCG 3’ Y 5’ CGGTACATGTCCTACGGCTACAATGCGATC 3’ Z 5’ TTACAGTGGACCTACGGCTACGTATGGGAC 3’ (b) What is branch migration? (c) What is the name of the enzyme that resolves a Holliday junction into two separate DNA duplexes? (d) On your diagram, indicate how the Holliday junction can be resolved in two different ways and draw the structures of the products.