Q: what molecular complex serves as a recognition. factor for premature stop codons? exon-junction…
A: Codons are the combinations of three nucleotides and specify the amino acids during the process of…
Q: 2 organisms with genotypes Bb Dd are mated assuming independent assortment of the B and D/d genes…
A: Alleles are the alternative forms of a gene that are located on the same locus of a homologous…
Q: Explain the reason why most proteins have less D-aspartate and elastin has increasing levels of D-…
A: Racemization is the process by which a pure mixture of enantiomers is completely transformed into a…
Q: Explain the way in which the neurons of the vertebrates avoid unproductive synapses with themselves…
A: A cell body, axons, and dendrites make up a neuron. Synapses are formed when the dendrites of one…
Q: Use the diagram on this website to label following on the chloroplast diagram.
A: Light-dependent reactions These reactions use light energy to make products of ATP and NADPH that…
Q: The fruit color of eggplants is an example of incomplete dominance since crossing deep purple…
A: The fruit color of egg plant depicts incomplete dominance. Let P allele encodes purple color. It is…
Q: Individuals undergoing anti-angiogenesis therapy with VEGF inhibitors often show initial reduction…
A: Vascular endothelial growth factor (VEGF) is a potent angiogenic factor and was first described as…
Q: Briefly describe one example of how the nervous, endocrine, and circulatory systems work in…
A: Introduction Our body is comprised of many different organ systems which has individual…
Q: If I have been exposed to an infectious microbe for the second time, which of the following…
A: Immunoglobins or Ig are released by the B-lymphocytes or B-cells and responsible for binding with…
Q: "In the small intestine, stem cells in the crypts divide asymmetrically to maintain the population…
A: The undifferentiated cells known as stem cells can develop into any kind of cell in the body. These…
Q: How many chromosomes were present before mitosis? How many chromosomes did each of the daughter…
A: 1 answer - There are 46 individual chromosomes in each cell. With 92 individual chromatic are…
Q: Which of the following does not contribute to genetic variation in sexual life cycles?…
A: The term "genetic variation" refers to the differences in the DNA sequence that make up each genome.…
Q: According to the findings, the challenges of preventing non-communicable diseases were classified…
A: Introduction Communicable diseases are diseases that can be spread from one person to another. They…
Q: the leftside. Briefly, explain how the semiconservative mode of DNA replication is supported by…
A: Semiconservative DNA replication was demonstrated by the Meselson and Stahl experiment. They tested…
Q: The determiner for brown eyes (B) is dominant to blue eyes (b) and is not X-linked. A colorblind man…
A: Given - Phenotype of the man - colorblind with brown eyes Since, the mother of the man is blue…
Q: 15. Now, transcribe and translate the DNA strand below. Remember to use the start and stop…
A: Transcription and translation are terms used to describe two distinct biological processes: the…
Q: Is the development of an individuals sense gender identity most accurately described as polygenic or…
A: Being a boy or a girl an unique feeling is very natural for most children.Gender identity means an…
Q: 5 Examples of postnatal cytogenetics test and applications
A: The term "cytogenetics" refers to the study of cellular aspects of heredity, particularly the…
Q: 7.) Give the base sequence of the complementary strand of DNA in this molecule. Label the 5' and 3'…
A: DNA is also called as Deoxyribonucleic acid which is an polymer composed of two polynucleotide…
Q: Cancer therapies directed solely at killing the rapidly dividing cells that make up the bulk of a…
A: A mistake in the regular cell cycle process results in cancer cells, which reproduce abnormally.…
Q: Point mutations in multiple tumor suppressor proteins have been linked to cancer. For example…
A: Introduction When one original DNA molecule is split into two identical replicas, this biological…
Q: Find FIVE processed or prepared foods or drinks, which are not desserts, or soda’s, that have an…
A: Nowadays people are trying to minimize the sugar consumption.According to the American Heart…
Q: Are there any medicines humans have used in the past,that we no longer can, due to loss of…
A: Traditional medicine is the term which we use to refer both systems such as Indian ayurbeda,Arabic…
Q: "In the early cleavage stages, when the embryo cannot yet feed, the developmental program is driven…
A: Cell division known as cleavage occurs when the gap stages of the cell cycle are bypassed and cell…
Q: Scientists carried out a microarray analysis to compare the gene expression of normal pancreatic…
A: Scientists can use microarray analysis to compare the gene expression of normal cells to that of…
Q: Many people in the developing world die of a water-borne illness simply because they do not have…
A: Cholera It refers to a bacteria disease caused by the bacteria Vibrio cholerae. It is usually spread…
Q: "As development progresses, individual cells become more and more restricted in the range of cell…
A: The capacity of a cell to differentiate into one or more specific cell types is known as its…
Q: QIESTION • Describe how do they engineer T cells to be used to succesfully treat cancer? • What are…
A: The second greatest reason for death worldwide is cancer. Any of the several illnesses characterized…
Q: Question 9 7 pts Part of the complement system of defense is opsonization. This process causes holes…
A: Part of the complement system of defense is opsonization. This process coats the pathogen exterior…
Q: Transcribe and translate the DNA strand below. Remember to use the start and stop sequences.…
A: DNA is converted into mRNA, which contains the instructions needed to make proteins through the…
Q: Expression and purification of proteins from E. coli is preferred over those from the host cells or…
A: Protein purification is a series of processes intended to isolate one or a few proteins from a…
Q: List and explain 3 histological identification (distinguishing) factors for each of the following: -…
A: We know that the digestive system includes the gastrointestinal tract and the accessory digestive…
Q: conclusion in making marinated fish
A: Marinating involves usage of common salt, juices like vinegar, lemon containing citric and acetic…
Q: what is Taxol ? What does it Target in cancer cells ? (relate it to cell communication and cell…
A: Introduction : The term "cancer" refers to disorders in which abnormal cells proliferate…
Q: You are a field biologist studying 14 species of rodent that are found on both sides of the Grand…
A: A phylogenetic tree is the diagrammatic representation of the evolutionary relationships among the…
Q: Point mutations in multiple tumor suppressor proteins have been linked to cancer. For example…
A: Note: Since you have posted a question with multiple sub-parts, we will solve the first three…
Q: Examine whether the statement "Stem cells, being stem cells, are by definition the same in all…
A: Stem cells have the capability of producing multiple cell types. Totipotent stem cells have the…
Q: College Level Biology 2 Honors Explain your answer in some depth and avoid just saying "It is A" or…
A: Introduction:- A population is defined as the group of individuals belonging to the same species…
Q: (common namel
A: The kingdom Plantae contains eukaryotes that mostly performs photosynthesis. Algae and fungi were…
Q: Why does sexual dimorphism have important implications for studying human evolution? Explain why and…
A: Sexual dimorphism is a condition in which the sexes of the same species have distinct morphological…
Q: romosomes and Heredity tiple Choice: Write the CAPITAL letter of your answer choice in the blank AND…
A: 1) A family chart, diagram or record or a history which indicates or determines the individual in…
Q: The World Health Organization (WHO) is seeking a candidate for one of their Global Health programs…
A: The World Health Organization (WHO) is a specialized agency of the United Nations that is concerned…
Q: Model 1 Mitosis as part of the Cell Cycle Metaphase Anaphase - Prophase XX (X) X Replicated…
A: Introduction : The cell goes through a series of processes that lead to the DNA and the cell being…
Q: Where were the earliest Homo erectus fossils found (not the first ones discovered)? How old are…
A: Homo erectus is also referred as the upright man. It was the first of our ancestors to have…
Q: What are the two pathways for transfer of electrons from bacteria into the anode surface in the…
A: A soluble artificial mediator is a chemical compound that is used to facilitate the transfer of…
Q: In a gorilla population in Zaire we consider a single gene locus with two alleles G and g, with G…
A: The Hardy-Weinberg formula is written as follows: p2 + 2pq + q2 = 1. Here, p represents the…
Q: A 25-year-old soldier suffers a gunshot wound on the lower part of his back and is unable to move…
A: Cauda equina or conus injuries have the potential to cause lower motor neuron damage. A bundle of…
Q: "Were the various types of cells to lose their stickiness for one another and for the supporting…
A: In the majority of tissues, transmembrane proteins that are intracellularly connected to the…
Q: Orrorin tugenesis may be the earliest hominin because it has a thigh bone that the discoverers say…
A: Orrorin tugenensis, who lived around 6 million years ago, is one of the oldest early humans on our…
Q: How is a cells suspension culture made?
A: Answer: Cell suspension culture is the process of replicating single cells more quickly in a liquid…
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
Step by step
Solved in 4 steps
- Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?Given the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the complementary mRNA sequence. Indicate direction of strand as 3'--> 5' or 5'--> 3' as in the given sequence above. Give the amino acid sequence of your mRNA sequencelin No. 1. Indicate direction of strand as above. Use all lowercase letters, 3-letter name of amino acid separated by a hyphen (-), no spaces in-between.5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. Write the resulting amino acid sequence using the 3 letter code. Write the answer in a all capital letters. Leave a space between the amino acids. Do not write 5' and 3'. 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. If the G in Bold changes to a T, then the result will be A) A nonsense mutation B) A frameshift mutation C) A silent substitution D) A missense mutation 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. If the G in Bold changes to a A, then the result will be A) A nonsenese mutation B) A frameshift mutation C) A silent substitution D) A missense mutation
- A portion of the sequence from the DNA coding strand of the chick ovalbumin gene is shown. Determine the partial amino acid sequence of the encoded protein. CTCAGAGTTCACCATGGGCTCCATCGGTGCAGCAAGCATGGAA-(1104 bp)-TTCTTTGGCAGATGTGTTTCCCCTTAAAAAGAA Enter the 3-letter abbreviation for each amino acid in sequence, separated with dashes, and no spaces (example: xxx-xxx-XXX-XXX...) The amino acid sequence is .1104bp..…........On the space provided, type the translation product of wild-type gene A (use three- letter abbreviation for the amino acids; use - to indicate a peptide bond). 5' CTAATCGCCTAATCCGCTTGCGGCCAT 3'The DNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using this sequence, write the sequence of the polypeptide that results from this gene. Be sure to appropriately label the ends of the molecule. 5'-ATGCACGGCGACTAG-3' Second letter A UAU Tyr UAC First letter U A G U UUU1 UUC UUA LOU Leu CUU CUC CUA CUG Phe GUU GUC GUA GUG Leu AUU AUC lle AUA AUG Met Val C UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala CAU His CAC CAA CAG Gin AAU Asn AAC AAA 1 Lys AAG LYS G {}a UAA Stop UGA Stop A UAG Stop UGG Trp GAU 1 GAC Asp GAA GIU Glu GAGJ UGU UGC CGU CGC CGA CGG AGU AGC AGA AGG Cys GGU GGC GGA GGG Arg Ser Arg DOA DOA DOA DUTO Third letter Gly
- 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. Write the resulting amino acid sequence using the 3 letter code. Write the answer in a all capital letters. Leave a space between the amino acids. Do not write 5' and 3'.For the messenger RNA sequence below, find the beginning of the amino acid coding sequence and translate the sequence using the genetic code provided below. 5' - AAUUAUGGGCAAUAUGCCGGGCcGGUUAAGCG - 3' Second Letter A UGU cys u UGC Phe UCU UU U UUC UUA UAU Tyr Ser UAC UAA UAG Leu UCA Stop UGA Stop UUG UCG Stop UGG Trp CUU CU CAU His CGU c cuc Leu ccc ССА CCG Pro CÁC CAA CAG CGC CGA CGG Arg CUA CUG Gin 1st 3rd letter Ser u letter AUU ACU AAU AAC AAA AAG Asn A AUC AUA AUG lle ACC ACA AGU AGC AGA AGG Thr Lys Arg Met ACG GUU G GUC GUA GUG GCU GAU GAC GAA Asp GGU Val GCC Ala GGC Gly GCA GGA Glu GCG GAG GGG GThe BNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using this sequence, write the sequence of the polypeptide that results from this gene. Be sure to appropriately label the ends of the molecule. 5'-ATGCACGGCGACTAG-3' Second letter A UAU Tyr UAC First letter U P с > < A G U UUU UUC Phe UUA UUG CUU CUC CUA CUG L GUU GUC GUA GUG Leu Leu AUU AUC lle AUA AUG Met Val C UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala Cys UAA Stop UGA Stop A Trp UAG Stop UGG CAC His CGU J CGC CAA I CGA Gin CAGG CGG AAA 1 AAG Lys UGU UGC AAU Asn AGC} AAC GAC Asp GAA GAGGIU For the toolbar, press ALT+F10 (PC) or ALT+FN+F10 (Mac). BIUS Paragraph V Arial G 1 AGA 1 AGG GGU GGC GGA GGG Arg Ser Arg Gly V DCAG DCA DOA UCAG Third letter 10pt < Av V IX Q ... O WORDS POWERED BY TINY
- The DNA in the coding strand below contains a short imaginary sequence for a short protein in Squibillus notables (imaginary bacterial organism). Indicate the mRNA and amino acid sequences. Label the 5' and 3' ends, the amino (N-terminus) and carboxyl (C-terminus) ends and start/stop codons, if present, as appropriate. 5'- ATGTACCTCGACGATCAAGGCAA -3'Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs (what letters changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions (with spaces), and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - CCTCGTTATGTG - 5' Mutated DNA Sequence: 3' - CCTCGTTATTTG - 5'Part of a sequence of DNA from a person without this genetic disease is: TAG TAA AAA CCA CCC AGG Part of a sequence of DNA from a person with a genetic disease is: TAG TAA CCA CCC AGG The possible codons for some amino acids are shown in the table. Amino acid Codons glycine GGU GGC GGA GGG isoleucine AUU AUC phenylalanine UUU UUC serine UCU UCC UCA UCG Which amino acid is missing from a person with this genetic disease? serine glycine O phenylalanine isoleucine