Choose the five correct labels for the figure Enzyme Active site Substrate binds at the enzyme active site (E+S)+ 5 Enzyme-substrate complex 1 2 Products form in the enzyme active site 3 Enzyme Products dissociate from enzyme active site 4
Q: As the leading scientist in a biomedical science laboratory, it is up to you to give advice to your…
A: Polymerase chain reaction or PCR s a method to obtained large number of copies of a target DNA…
Q: The PI of protein P is 7.3. One can purify protein P by:
A: The proteins are composed of twenty naturally occurring amino acids that are linked vis peptide…
Q: In the enolase reaction, the Lys 345 and Glu 211 residues participate in the reaction to convert…
A: Enolase is an enzyme which catalyzes the conversion of 2-phosphoglycerate to phosphoenolpyruvate.…
Q: AMP is an activator of fructose 1,6-bisphosphatase (FBPase-1) True False
A: Glycolysis is the process by which one molecule of 6 carbon glucose is broken down into 2 molecules…
Q: n which of the test tubes would you say hydrolysis has taken place in this experiment? Why?
A: Enzymes are large molecular weight proteins that catalyse biochemical reactions. The substrate bind…
Q: 4. A tRNA has the anticodon sequence 3'-CAG-5'. What amino acid does it carry? Illustrate how the…
A: As per the central dogma of molecular biology, genetic information is stored in the DNA. The genetic…
Q: Calculate for the initial pH, final pH, and buffer capacity if 0.1 mole of H+ is added to 1L of…
A: The reaction that would take place when we add H+ (here H+ is the acid added) into the given buffer…
Q: why is having a more reductive environment will alter the functional characteristics of alpha…
A: Keratin is a protein that is of two types: alpha and beta keratin. Alpha keratin is alpha helix…
Q: Briefly explain the Warburg Effect. How can the Warburg effect be taken advantage
A: INTRODUCTION : Glycolysis : It is a metabolic pathway of the cells of body,in which Glucose is…
Q: H K Br Br H trans-2,3-dibromo-2-butene cis-1,2-dibromoethene Otrans-1,2-dibromoethene…
A: The structure given the question represents- Answer- trans - 1,2- dibromoethene
Q: What is dideoxy sequencing? Explain it please.
A: Introduction DNA or deoxynucleotide acts as genetic material in our body. DNA contains nitrogenous…
Q: write the mechanism for the reaction of CO2 and the amino terminal of the alpha-1 chain of…
A: Hemoglobin is a multimeric protein that transports oxygen and CO2 in the body. A hemoglobin molecule…
Q: 3. Supra-secondary structures of proteins - supercoiled alpha- helix, Greek key, meander, interlock,…
A: Protein: The amino acids are arranged in a long chain and joined to one another by covalent peptide…
Q: Definition of carbohydrate metabolic disorder. introduce other carbohydrate disorders along with…
A: Introduction: The term metabolism is the process by which our body makes energy from the food that…
Q: Fumerase is an enzyme in the citric acid cycle that catalyzes the conversion of fumerate to…
A: Parameters such as Km and Vmax are used for comparing enzyme activities. If we know the initial rate…
Q: Suppose there is a glycolytic-like pathway carried out by an alien species that uses analogous…
A: The reversible aldolase reaction in glycolytic pathway cleaves a 6 carbon keto-bisphosphate into a 3…
Q: Can someone give me an understanding of Products and Reactants? The first image is from the the…
A: Chemical reactions are processes that convert reactants into products. Some of the chemical…
Q: True or False for each question ( ) Guanine, Adenine, Uracil, and Cytosine are commonly found…
A: The biological macromolecules are classified as nucleic acids, proteins, lipids and carbohydrates.…
Q: Which of the following is zwitterion structure of the amino acid alanine? O NH3 NH3 O NH₂ O OH O no…
A: Amino acids are biomolecules that have an amino group (-NH2), a carboxyl group (-COOH) and a side…
Q: Question 21 of 25 What are Gram-negative bacteria? Select the correct response(s): They have a cell…
A:
Q: Question 15 of 25 Which of the following is true for the acid-base properties of amino acids? Select…
A: Amino acids are the building blocks of proteins . they have two functional groups amine group and…
Q: Among the given statements, which ones correctly describe the commonality in dopamine and…
A: The adrenal gland secretes three catecholamines-dopamine, epinephrine and norepinephrine. Dopamine…
Q: Explain the indirect effect that allosteric effectors have on pyruvate dehydrogenase activity…
A: The pyruvate dehydrogenase complex is composed of three subunits named pyruvate dehydrogenase,…
Q: Question 9 Which of the following fatty acid does have greater solubility in wat O 16:0 O 18:0 O…
A: Fatty acids are a class of lipids that are nonpolar and are insoluble in water. The naturally…
Q: Determine the chemical formula for the following molecules by counting the Carbon, Hydrogen and…
A: Introduction : Carbohydrates - Also known as carbs, are sugar molecules which consists of…
Q: 5. State whether the following statements are True or False, If False, explain why 5.1 Oxaloacetate…
A: 1. Oxaloacetate is formed by the oxidation of L-malate - Oxaloacetate is formed via oxidation of…
Q: Determine the chemical formula for each of the following carbohydrates. Use the ratio for…
A: The body's primary source of energy is carbohydrates. These are the dietary fibre, sugars, and…
Q: 1. DNA: ATACGAAATCGCGATCGCGGCGATTCGG mRNA: Codon: Anticodon: Amino Acids:
A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…
Q: RNA polymerase is found in the mitochondrial matrix. True False
A: The "powerhouses" of the cell are frequently referred to as mitochondria. They assist in converting…
Q: Q6.1: Three critical features of enzyme structure and function contribute to the overall efficiency…
A: The enzymes are biological catalysts that increases the rate of biochemical reactions. The enzymes…
Q: 5. In the early days of protein biochemistry, these proteins were described using "operational…
A: Operational definition is applicable to many things in our everyday life. It is most popularly used…
Q: Identify if SN1, SN2 and so forth. Catabolism of triacylglycerols- beta-oxidation pathway…
A: SN1 and SN2 are common reactions in organic chemistry. SN1 is a two step reaction i.e., substitution…
Q: b) Why might the compound shown below act as a transition state analog of phosphoglucose isomerase?…
A: Nitrogen containing transition state analogues are used to inhibit the isomerization reaction of…
Q: State what each of the following symbols stands for, be specific. 4. M 5. SD 6. α
A: Introduction There are various symbols are used in science. Scientific writing requires various…
Q: What is the hydrodynamic stress of bioreactors when there are cell cultures?
A: Introduction A bioreactor is a vessel or manufactured device which gives biologically active…
Q: Given 2 M Tris, pH 7.1 (pKa 8.0), 5 M NaOH, 5 M HCI, and water; how would you prepare 2 L of 0.2 M…
A: Equation of dilution: M1V1 = M2V2 where: M1 is the molar concentration of the stock solution. M2 is…
Q: Since higher concentration colcemid will result in shorter chromosome, you want to change your…
A: It is given that: Molar concentration of the stock solution: 10 ug/ml. Desired dilution…
Q: Select the correct response:
A: Tyrosine gives rise to catecholamines which includes dopamine, norepinephrine, and epinephrine.
Q: Enzyme X exhibits maximum activity at pH = 6.3. X shows a fairly sharp decrease in its activity when…
A: Most enzymes are proteins and proteins are primarily made up of amino acids. Amino acids bond with…
Q: Given the following reaction and equation for the initial velocity of the reaction: k₁ k3 E+SES E +…
A: We are given two equations for initial velocity (V). V=kcat [ES] -------(eq1) andV=k3 [ES]…
Q: Write the schematic diagram of lodine Value Determination as shown in the video by Amrita Vlab:
A: Simple fats are triglycerides. Triglycerides or triacylglycerols are fatty acid esters of glycerol.…
Q: Lipogenesis, or fatty acid synthesis, occurs in several cycles. A diagram of the reactions of the…
A: De novo synthesis of fatty acids takes place in the cytosol of all eukaryotes. Fatty acids are…
Q: a) What is the Kd you measure for this interaction?
A: INTRODUCTION : Actin - Actin is a family of globular multi-functional proteins which form…
Q: Why are single strand binding proteins (ssb proteins) needed in DNA replication? (note that you need…
A: DNA consists of two strands of polynucleotide that are linked to each other via hydrogen bonding…
Q: Below is a fractional saturation curve for O2 binding to adult hemoglobin. Assume that curve Y…
A: Fractional saturation curve of Haemoglobin for oxygen binding describes the amount of oxygen that is…
Q: Indicate whether the following pairs of monosaccharides are aldoses or ketoses. a. D-altrose &…
A: INTRODUCTION : Monosaccharides : They are also known as simple sugar. They are the simplest forms of…
Q: See the oligopeptide below. Compare the quantities of high energy molecules (e.g. ATP/ADP/AMP,…
A: Oligopeptides: It contains from two to twenty amino acids and may be made up of dipeptides,…
Q: Ph.D Fernando, Harvard Professor of Genetic Epidemiology, knows a thing or two about Twins. He must…
A: S-adenosyl-methionine: It is a typical cosubstrate used in amino-propylation, transsulfuration,…
Q: Thick filaments are part of the I band contain actin O contain myosin but thin filaments do/are not.…
A: In each microfibril, actin thin filaments and myosin thick filaments are organized into a linear…
Q: Which of the following statements about protein folding is incorrect? Select all. GroEL/GroES allow…
A: The proteins fold into their proper three dimensional structure in order to be biologically active.…
Step by step
Solved in 2 steps
- The blue structure in the diagram below is an enzyme. Please discuss what these diagrams (A and B) show. Please explain whether the grey tube within the enzyme would be effective as a drug or medication to inhibit this enzyme in both A and B. What type of drug or medication would this be called? A B ( ES ES OO #Please handraw this graph with all the necessary detailed information: Imagine that I text enzyme rate for four different temperatures: 10 degrees celsius, 20 degrees celsisus, 30 degree celsius, and 40 degree celsius, in separate tubes. The enzyme appears to work faster as temperature increases, but completely ceases activity at 40 degrees celcius. Sketch a graph to show this outcome, but here you will graph product formation (nmoles/mL) vs. time (minutes). The graph should be 4 lines and HANDDRAWN. Include a legend if necessary. You do not need precise quantitivate values, but most show the correct trends on the graph.substrate active site enzyme enzyme + substrate entering active site FIGURE 5 enzyme changes shape slightly as substrate enters active site, making the fit more precise enzyme/substrate complex Lock : Key enzyme/products complex products 5 enzyme + products leaving active site 5. Looking at Figure 5 above, how is the enzyme similar to a lock and a key? 6. Complete the following analogy using the terms show in figure 5 (Enzyme and Substrate). 7. If the substrate in the first image in the left of the series is a disaccharide such as sucrose, what is the enzyme doing to the disaccharide? 8. The picture above is showing what is known in biochemistry as the "lock and key theory." Explain why you think this theory is used to describe enzymes.
- An enzyme facilitate catalysis by formation of ester bond with an alcoholic substrate. Which amino acid residues can facilitate such mechanism of catalysis? Select the correct response: Cys and Met Lys and Arg Ser and Tyr Glu and Asp| 2 3 I 4 I 5 I 6 I 7 Directions: Graph the data (line graph); label both axes. DATA TABLE 1 Temperature (°C) Enzyme Activity 10 10 20 15 30 25 40 45 50 35 60 20 Temperature (C) 1. According to the graph, what is the best (optimum) temperature for enzyme activity? Explain your reasoning. 2. What happens to the enzyme above the optimum temperature? 26°F F12 PrtSc Insert Delete F7 FO F9 Backspac 7 8. R P G K 近asrealize.com/assignments/viewer/classes/61227fd32e355544e0a77ded/assignr ng of Enzymes nzymes Effects of Enzymes This graph shows the effects of an enzyme on a particular reaction. The red line on the graph shows the reaction without the enzyme while the blue line shows how the reaction progresses with the enzyme. 2. According to the graph, the enzyme V Choose... affect the initial energy of the reactants. The enzyme V Choose... the activation energy. The overall energy released Check Answer
- In the following example an enzyme is being inhibited. This is an example of Active site Inhibitor Altered active site O Non-competitive inhibition O Competitive inhibition MacBook AirWhat is the minimum and maximum pH in which Enzyme X will work? What is the optimal (best) pH? Y 1 2 3 4 5 678 91011121314 pH Rate of Enzyme ActionWhich figure represents the non- competitively inhibited enzyme? Substrate Inhibitor Active Site Taanh Figure 2 1anpoad apeagng laug asgng adues Enzyme O Figure 1 Figure 2 O Figure 3
- FIGURE 6 substrate active site enzyme substrate denatured enzyme substrate cannot enter binding site 3 C enzyme products leaving active site substrate denatured enzyme 13. Figure 6 above shows what happens to an enzyme when exposed to heat. How is this similar to what happened to my crayons? 14. What term is used to describe when the shape of the enzyme has been altered? (Look at the figure in the middle!) 15. Can you predict other things that may influence the activity of enzymes in a positive or negative way?Name: Sincere Frias Date: (0/2/2od0 Period Ced th nzy ck. Enzyme Models & Factors Affecting Enzyme Action PART I – Lock and Key Model st In this part you will construct models of enzymes. Remove the last page and cut all shapes out. 2. The different shapes will represent both enzymes and substrates. 3. Match up as many of the pieces as you can. 1. Questions 1. The enzyme maltase combines the substrates h ydrolysis + Starch molecule to produce the disaccharide maltose. 2. The enzyme ATPase combines the substrates_molecule and to produce the ATP (Adenosine TriPhospate). Iriglyceride 3. The enzyme lipase works on the substrate called 4. The enzyme phosphatase works on the substrate called 5. What is the relationship between the substrate and the enzyme?I. Indicate whether each of the following statements are true or false. _1. According to the lock-and-key model of enzyme action, the active site of an enzyme is flexible in shape. 2. In an enzyme-catalyzed reaction, the compound that undergoes a chemical change is called the substrate. 3. The nonprotein portion of a conjugated enzyme is the enzyme's active site. _4. Simple enzymes have inorganic cofactors, and conjugated enzymes have organic cofactors. 5. Vitamins are required in minute quantities for normal cellular function. 6. vitamins are found in all food groups. 7. Ribose sugars are found on one chain of the DNA molecule and deoxyribose sugars are found on the other chain of the DNA molecule. 8. A DNA molecule has a double helix at one end of the molecule and a single helix at the other end of the molecule. _9. Complementary bases are held together by covalent bonds. 10. DNA molecules always contain the nitrogenous base thymine.