Describe the process of transcription in as much detail as possible using pictures and words beginning with a paired (duplexed) strand of DNA and ending with a processed mRNA which is ready for translation.
Q: describe the process of transcription, explaining how DNA, RNA, and RNA polymerase interact to…
A: Genetic information in our cell is carried out from DNA to RNA and then to proteins. These proteins…
Q: Consider this list (below) of steps involved in transcription. These steps are out of order.…
A: Replication, transcription, and translation are used by all cells to keep track of their genetic…
Q: Summarize the two steps below AND indicate the specific location within a cell where each.…
A: DNA DNA is a long polynucleotide chain containing information about polypeptide chain.
Q: Distinguish between the initiation process in Transcription and the initiation process in…
A: Replication, Transcription and translation is vital steps that help in molecular basis of…
Q: Describe how protein are created in translation. Step by step
A: The translation is the process of protein synthesis.
Q: Describe all the elements required to carry out the process of translation.
A: What is translation Translation refers to the process of polymerization of amino acids to form a…
Q: Explain how the translation and degradation of an mRNA may be controlled by RNA-binding proteins.
A: mRNA or messenger RNA (Ribonucleic acid) is bound by many RNA-binding proteins throughout its…
Q: Briefly describe how transcription works and show that you understand the difference between…
A: Transcription is the process of formation of a sequence of RNA using DNA as a template and DNA…
Q: Describe the roles of RNA molecules in gene expression.
A: We know that An RNA is a single-stranded helical structure that is present in all biological cells.…
Q: Describe the effects of changing the promoter on the transcription of the DNA strand/gene the…
A: The promoter is the DNA (deoxyribonucleic acid) element that binds to the RNA (ribonucleic acid)…
Q: Explain what happens during transcription.
A: The DNA (deoxyribonucleic acid) is the hereditary unit of an organism. It consists of purines and…
Q: describe a scenario (as you would to a 12th grader) a physiological situation (protein need) that…
A: CENTRAL DOGMA- Replication is the process when DNA replicates itself means it will make copies of…
Q: List and explain the steps of transcription
A: Initiation, promoter clearing, elongation, and termination are the four main stages of…
Q: Indicate 2 ways which ensure DNA fidelity when carrying the message to protein which occur in the…
A: DNA fidelity refers to the ability of the DNA polymerase to avoid or rectify the errors made in the…
Q: In details summarize the process of transcription.
A: Transcription is the process of copying the DNA bases and converted into single-stranded mRNA…
Q: Contrast the roles of tRNA and mRNA during translation, and list all enzymes that participate in the…
A: Ribonucleic acid (RNA) also contains genetic material but rarely takes part…
Q: Describe the process of transcription. Your answer should be at least a full paragraph (3-7…
A: Question - Describe the process of transcription. Your answer should be at least a full paragraph…
Q: Describe initiation of translation
A: At the end of the transcription process, the translation process begins. The translation is the…
Q: Describe the process of transcription, focusing on the role of RNA polymerase, sigma (σ) factors,…
A: Transcription is a process of transcribing the template DNA into complementary mRNA sequence which…
Q: Explain the process of transcription in prokaryotes, including the following: promoter region, RNA…
A: The DNA is the genetic material that is passed from one generation to the next generation. It is…
Q: In details summarize the process of Translation and post translation process.
A: Translation: Nucleotide language is transfer to language of amino acids. In short mRNA language is…
Q: If the sequence of DNA on the template strand of a gene is AAA,the mRNA codon produced by…
A: Transcription is the process of formation of RNA using the DNA template strand. Both strands of a…
Q: If the sequence of the coding strand in a transcription unit is written as follows: 5'-…
A: In that question we have to write down the sequence of mRNA.
Q: Identify three ways transcription is different from replication.
A: Transcription: The formation of RNA take place from the template strand DNA. It occurs to form RNA…
Q: Explain how DNA transcription occurs and what is formed by this process.
A: The central dogma of molecular biology, given by Dr. Francis Crick states that the information…
Q: Describe the roles of mRNA, tRNA, and rRNA intranslating the genetic code.
A: During protein synthesis, translation is transforming the sequence of a messenger RNA (mRNA)…
Q: Outline the three stages of translation.
A: The process of synthesis proteins from ribosomes in cytoplasm or endoplasmic reticulum is defined as…
Q: Explain synthesis of RNA in a flow chart- from pre-mRNA to final mature RNA.
A: The RNA transcript first made in a eukaryotic cell is known as pre mRNA. It must be processed into…
Q: Explain Different Stages in Transcription Process.
A: Gene is the basic unit of heredity of all life forms. This is found to be transferable from the…
Q: Describe the roles of RNA molecules in gene expression
A: RNA is an important biological macromolecule that is present in all biological cells. It is…
Q: Describe the process of transcription.
A: The method of copying a part of DNA into RNA is known as transcription. Messenger RNA (mRNA) is made…
Q: Describe transcription, including the processes of initiation, elongation, and termination.
A: Transcription is one of the processes in central dogma in which information of DNA transcribed into…
Q: Compare transcription to translation. Which of the process is mostly related to errors?
A: Transcription vs Translation Initiation- The transcription process is the beginning of the gene…
Q: Describe how mRNA is created in transcription step by step.
A: Gene expression is a cycle by which the qualities are gone on to frame RNA and proteins. This is…
Q: Describe the key steps of translation
A: Translation is the process of polymerization of amino acids to form a polypeptide. The order and…
Q: Describe the steps in transcription that require complementary base pairing
A: Transcription is a process of synthesis of ribonucleic acid (RNA) especially messenger ribonucleic…
Q: Relate the major events of transcription.
A: Transcription is the process of synthesis of messenger RNA (mRNA) from structural genes in DNA…
Q: Explain how mRNA plays a role in all three stages of translation.
A: Introduction: Central dogma is a two-step process and constitutes transcription and translation.…
Q: Describe the recognition process by which the tRNA for Nformylmethionine interacts with the portion…
A: N-formylmethionine is a derivative of the amino acid methionine in which a formyl group has been…
Q: The nucleotide at which transcription is initiated is called 1. -10 2. +1 3. -35 4. 0 5. -1
A: Transcription is the process by which gene are made to mrna sequence.
Q: Describe the effects of transcription factors on gene transcription
A: Transcription is a process by which the information of a strand of DNA is copied into a new molecule…
Q: In details summarize the process of transcription.
A: Two questions are asked. I will answer first question, as per guidelines. Transcription The DNA…
Q: Explain the process of Transcription?
A: The process by which the information contained in a particular segment of DNA is copied into a…
Q: Discuss the process of translation and how this differs from transcription
A: The process of protein synthesis from an mRNA template which is further converted into an amino acid…
Q: In a written paragraph, describe the difference between prokaryotic and eukaryotic TRANSCRIPTION. In…
A: The process in which the information is stored in the DNA and transferred to an mRNA by the process…
Q: Based on your understanding of transcription, place the following events in the correct order.
A: The act of transcribing information from a strand of DNA into a new messenger RNA molecule is known…
Q: Summarize the mRNA translation steps of protein synthesis, which are: initiation, elongation, and…
A: Translation is the process of synthesis of proteins from mRNA.
Step by step
Solved in 2 steps with 1 images
- a. An oligopeptide ALVGALGATPTPQMWSHSWRGVSIKS was digested with trypsin.Which method would be most appropriate for separating the products: ion exchange or gel filtration chromatography? Explain.b. Suppose that the peptide was digested with cyanogen bromide. What would be the optimal separation technique? ExplainOriginal sequence: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ Question: 4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this? 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-310. A portion of 5'-AUGCCACGAGUUGAC-3'. What amino acid sequence does this code for? To answer the question please: I) explain what is the genetic code and list the properties of the genetic e 2) draw a diagram of protein synthesis; 3) determine which tRNA should be attached to the mRNA; 4) what is the anticodon for the very first tRNA that will attach to mRNA? mRNA molecule has the sequence an
- a. Describe the different stages that occur during the translationprocess of Protein Synthesis.(b) using four examples of antibiotic inhibitors of translation, outlinehow inhibition occurs.High salt concentrations tend to cause protein aggregation. Suggest a way to identify proteins normalexpressed in particular bacterial species that can retaintheir solubility despite high salt conditions.You continue to study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 1 20 ORI 40 60 TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGIAATATĞGGGATGCACTATC 5' 3' AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCA'NTATAÇCCCTACGTGATAG CACTATC promoter RNA polymerase ribosome
- I. A protein, X, was Isolated from a pathogenlc mlcroorganism. The proteln Is a vlrulence factor whose path0genlclty lies In a heptapeptide of unknown sequence. After trypsin cleavage of the heptapeptide from protein X, the peptlde's compOsition and sequence was determined. The fOllowing were the results of the sequenclng process: 1. When the peptide was treated with dinitrofluorobenzene (DNFB), DNP-asp and a mixture of amino acids were produced. 2. When the same Intact peptide was treated with streptococcal protease, a pentapeptide of composition asp, asN, cys, gly and ser and 2 amlno acids were released. 3. When the heptapeptlde was also treated with hydrOxylamine HCI, a tripeptide and a tetrapeptide were obtained. The C-terminal amino acid of the tripeptide was asN. 1) What is the sequence of the heptapeptide if it is composed of cys, asp, lys, asN, gly and ser only? 2) What is the pl of the heptapeptide?Why Dil. naOH is very soluble in yeast rna?.A protein gives a single band on SDS gel electrophoresis, as shown in lanes 1 and 2 below. There is little if any effect from adding
- Affinity chromatography You have created a fusion protein tagged with Glutathione-S-Transferase (GST). Your lab mate tells you that the affinity columns for this type of tagged protein are very similar to that of Histadine tagged proteins. Using the following elements set up a purification column and construct a protocol for an affinity purification using this tag. A large amount of glutathione is usually used to elute the tagged protein off the column. How might this work?E. PROTEIN PRIMARY STRUCTURE ELUCIDATION. 1. Determine the primary structure of the protein described below. Write the final sequence using the corresponding three-letter code for each amino acid. Example: M-F-Y-R should be written as Met-Phe-Tyr-Arg Treatment with cyanogen bromide and sequencing yields the following peptide fragments: o D-M o R-A-Y-G-N o L-F-M Chymotrypsin digestion and sequencing yields the following peptide fragments: o G-N D-M-L-F o M-R-A-Y o oб. Draw all possible products of a single hydrolysis being completed on the following polypeptide: Ala-Ser-Met-Ser