Describe the similarities in sexual reproduction of moss and fern.

Q: When Replacement of the original gene occurs ?

A: A gene is the essential physical and functional unit of heredity. They are comprised of DNA…

Q: 2. In the guinea pig, a locus controlling coat color may be occupied by any of 4 alleles with the…

A: Introduction :  4 alleles control coat colour of guinea pig  Black = B  Sepia = S  Cream = C  Albino…

Q: What are some of the favorable features that made Mendel choose peas?

A: Mendel proposed the laws of inheritance. It provided a mathematical basis for genetics. He chose pea…

Q: Calculate the CFU/mL of the original culture for the countable plate as shown in the diagram. b) How…

A: Introduction :- CFU( colony forming units ) are the count of cells present in orginal culture which…

Q: Describe the nature and extent of genetic variation, including genetic polymorphism, balanced…

A: There are basically three types of genetic variation. These are:   Single base-pair substitution –…

Q: Charles Darwin once said, “It is not the strongest of the species that survive, nor the most…

A: This is a misquote with special reference to Charles Darwin regarding The Origin of Species in 1859.…

Q: Complete the formula for the Krebs Cycle: glucose (sugar) + carbon dioxide anergy C8 ATP)

A: In case of aerobic respiration, single molecule of glucose results in the production of 38 molecules…

Q: Independent assortment means that:   the segregation of one gene pair occurs as if no other gene…

A: The law of independent assortment states that the alleles of different genes are inherited…

Q: For some traits, one allele is not completely dominant to another.  Incomplete dominance occurs when…

A: Incomplete dominant traits are those traits in which one allele is not completely dominant to…

Q: What role does NAD+ play in redox reactions? a. NAD+, an oxidizing agent, can accept electrons and…

A: The role of NAD+ is discussed in step 2 with an explanation.

Q: Circulation II Which vessel direstly drains the given organ/structure in the cat? Spleen Small…

A: Introduction :- Circulation is the mass flow of fluid through the tissues and organs of an animal…

Q: 'Gamma-delta' T cells differ from 'alpha-beta' T cells by all of the following except O alpha-beta…

A: 'Gamma-delta' T cells differ from 'alpha-beta' T cells by all of the following except A. alpha-beta…

Q: 5' AUGAGGAUGGCCAGUCAAUUUGA 3' 5' AUGGAUGGCCAGUGCAUUUGA 1. Missense 3' 2. Silent 5'…

A: Frameshift deletion occurs when one or more than one nucleotide in a nucleic acid is removed,…

Q: How is RNAPol recruited to the correct place along the DNA to begin transcription at the +1 site?

A: Site of DNA where first nucleotide is transcribed is termed as +1 or initiation site.

Q: What are some of the advantages and disadvantages of utilizing insects as experimental animals in…

A: Insects are one of most commonly used experimental model which helps in various ways in clinical and…

Q: Gene and regulation of gene activity.

A: Gene regulation means how a cell regulate which genes are expressed among many other genes and…

Q: Apart from the medicine ,and industry, list four to five more applications of recombinant DNA…

A: Recombinant DNA technology is the joining together of DNA molecules from two different species.…

Q: Draw a diagram showing what pGEM will look like after it has been digested with BamHI.

A: BamHI: BamHI is a restriction enzyme obtained from Bacillus amyloliquefaciens that specifically cuts…

Q: Agglutination is used only in vivo. to detect bacterial diseases. often as a substitute for…

A: Agglutination refers to the clumping of cells due to result of aggregation between antigen and…

Q: Following the arrival of an action potential in stimulated cells, synaptic vesicles rapidly fuse…

A: Action potential Is an instantaneous, fast, temporary, and spreading change in the resting membrane…

Q: Compare the structures and functions of the receptor molecules for salty and sour taste; the…

A: In our body, taste receptors are that kind of receptors who can senses the taste of food in oir…

Q: Design a laboratory protocol to develop a monoclonal or polyclonal antibody against a protein of…

A: Antibodies, also known as immunoglobulins, are protein molecules produced by the body's immune…

Q: List some ways to prevent spoilage of canned food.

A: Prevention of canned food spoilage.

Q: How can the heart be strong enough to pump blood up your legs against gravity?

A: The heart is incapable of pumping blood back up the veins in your legs and back to your heart on its…

Q: In a genomic analysis looking for a specific disease gene,one candidate gene was found to have a…

A: The discovery, measurement, or comparison of genomic properties such as DNA sequence, structural…

Q: explain about the genetic drift   -differentiate founder effect from bottleneck effect.

A: Genetic drift or allelic drift is the change in the frequency of a gene variant in a population due…

Q: Supposed you have two individual peas. One of the peas is a pure breed with round green seeds while…

A: The Punnett square is a type of square diagram that is used to predict the genotypes of a particular…

Q: What biochemical mechanism underlies affinity maturation of the antibody response?

A: Antibodies mediate the adaptive immune response and are produced by plasma cells.

Q: 7. Sulfonamides are used to treat bacterial infections. Why these medicines do possess antibacterial…

A: As Guidelines you are not allowed to answer more than three sub quotation at a time please ask rest…

Q: 1. What is the area (in cm^2) of a small square in hemacytometer?

A:

Q: 9. Two varieties of pumpkin with different weights were crossed: 5 lb. and 29 Ib. 3/195 of the F2…

A: The term "phenotype" refers to the observable physical properties of an organism; those consist of…

Q: specific strategies used by health professionals patients, and the general public to prevent…

A: Antibiotics are the drugs(medicine ) used to treat the bacterial infection. There are so many…

Q: 21. Which macromolecules always contain carbon, hydrogen, oxygen, nitrogen, and sulfur? A. nucleic…

A: Introduction:- Any exceedingly big molecule with a diameter ranging from roughly(105 to 103 mm) is…

Q: 6. Consider the following biochemical pathway: precursor compound I enzyme enzyme A В compound II…

A: The fungus Neurospora was used by Beadle and Tatum to manipulate the biochemical outcomes of…

Q: The hypothalamus releases antidiuretic hormone that reduces urine formation in the kidney. Under…

A: Antidiuretic hormone (ADH) is a hormone that helps your body regulate the amount of water that…

Q: : These are the specific name of an independent taxonomic group of any rank.  A. Character B.…

A: These are the specific name of an independent taxonomic group of any rank Correct option is c.taxon…

Q: The experiment uses a redox titration method to measure Vitamin C content in a tablet. Why you…

A: * Vitamin C  ascorbic acid is an antioxidant essential for humans this deficiency can lead to a…

Q: Reproduction is usually secual with both male and female sexes, however asexual reproduction does…

A: Parthenogenesis is the type of asexual reproduction involving the development of female gametes…

Q: 9. Two varieties of pumpkin with different weights were crossed: 5 lb. and 29 lb. 3/195 of the F2…

A: aabbccdd=5 lb  AABBCCDD = 29 lb  P: aabbccdd × AABBCCDD   F1: AaBbCcDd

Q: Discuss the principles and applications of Laser-Doppler Anemometer to Agricultural and Biosystems…

A: Laser-Doppler anemometers (LDAs) are non-intrusive optical instruments that can be used to measure…

Q: Given the DNA strand with sequence 5' AUGGAGGAUGGCCAGUCAAUUUGA 3' match the various mutations to the…

A: Codon is a sequence of three nucleotides that corresponds to a specific amino acid. Codons encode…

Q: Food is a limiting factor for plants. A. TRUE B. FALSE

A: Living organisms can be classified into two types based on their mode of nutrition. 1. Autotrophs…

Q: Identify the benefits and risks of Genetically Modified Organisms

A: Genetical Modified Organisms in Plants Genetical modified plants is nothing but modifying the DNA of…

Q: Enzymes are catalytic proteins or RNA molecules that accelerate chemical reactions. Substrates  are…

A: Enzymes are biocatalysis that helps to increase the rate of chemical reactions by lowering the…

Q: Are there any parts of the human body that get oxygen directly from the air and not from the blood?

A: The answer is YES.

Q: Which of the following is true of reverse transcriptase?a. It is required for the movement of DNA…

A: The enzyme engaged in reverse transcription is reverse transcriptase. The enzyme works through using…

Q: 4. Why do you think is the classification of organisms important? 5. Do you personally agree with…

A: Introduction Biological classification refers to the process of arrangements of living organisms…

Q: 1.Transcription factors (TFs) bind to promoter sequences on DNA because the shape of DNA at that…

A: Transcription is a part of central dogma, in which the DNA molecule is converted into mRNA by…

Q: Illustrate and explain a back crossing and give a reason why such a mating plan is practical in…

A: Back crossing is very useful in genetics to separate specific characteristic in a group of organism.

Q: What happens to sepals, petals, and stamens after fertilization? State the fate of zygote, ovule,…

A: It is well known that the embryo sac is the site of zygote formation. The embryo sac is the location…

Angiosperm Reproduction

The process of sexual reproduction in flowering plants is known as angiosperm reproduction. In flowering plants, reproduction begins with pollination, or the transfer of male gametes (pollen) from the male reproductive organ (anther) to the female reproductive organ (pistil), and ends with fertilization of the female gametes (egg), which produces a zygote, which then grows to become a mature plant.