DNA Structure Provide a detailed (hand-drawn) structure of the double-stranded DNA GGATCC
Q: Composition as a mole fraction of one of a double-stranded DNA strand T = 0.22 and C = 0.30. In the…
A: Nucleic acids are the units of DNA or gene or chromosome. Genetic variation occurs due to…
Q: Given the following eukaryotic DNA strand, transcribe and translate the DNA into a polypeptide using…
A: the coding strand is given in the question which will replicate to form a template strand. Then…
Q: Below is a sequence of DNA.…
A: Introduction :- Adenine (A), thymine (T), cytosine (C), and guanine (G) are four nucleic acid bases…
Q: Single-stranded binding proteins (SSBPs) bind to single-stranded DNA at the replication fork and…
A: A pairs with T with2 hydrogen bonds and C pairs with G with 3 hydrogen bonds.
Q: Draw the full structure of the DNA dinucleotide C-T. Identify the 5′ and 3′ ends of this…
A: Deoxyribonucleic (DNA) acid is a double helix structure, which is composed of nucleotides joined by…
Q: Why are some transposons medically important?
A: Certain sequences are repetitive such as satellite DNA, transposable elements, etc. They are studied…
Q: The Universal Genetic Code Table can be used to determine the gene product of a given nucleotide…
A: mRNA consist of mononucleotide sequence that specifies amino acids sequence in peptide chain. One…
Q: Describe the basic structural features of DNA-binding proteins that allow them to recognize specific…
A: DNA binding proteins are proteins that have DNA binding domains and thus have a specific or affinity…
Q: Given the following eukaryotic DNA strand, transcribe and translate the DNA into a polypeptide using…
A: DNA strand – DNA is a Deoxyribonucleic acid. It is made up of two polynucleotide chains which are…
Q: Chironomus genomic DNA contains approximately 35.5% A. Estimate the percentages of G, C, and T in…
A: The double (ds) stranded DNA duplex structure follows the chargaffs rule, which suggests that the A…
Q: COMPLEMENTARY
A: COMPLEMENTARY DNA SEQUENCE OF GACGGCTTAAGATGC is given below
Q: explain how the biochemical structure of DNA allows it to function as the genetic materia
A: Introduction: Deoxyribonucleic acid, or DNA, is a molecule that provides the genetic instructions…
Q: AGTGCATTTCCAGGGA Above is a randomly generated sequence of DNA 16 bp long. Determine the Tm of this…
A: The Temperature of Melting (Tm) is defined as the temperature at which 50% of double stranded DNA is…
Q: Describe the Okazaki fragment and its formation in one of the strands of DNA essentiality of their…
A: Only while each strand of DNA is separated from an additional can DNA polymerase activity continue…
Q: Using this strand of DNA (TACAACTGA), show what a deletion and insertion would look like”
A: Nucleotides are subunits of DNA, and each nucleotide is made of a sugar molecule called deoxyribose,…
Q: Much of the stability of the double-stranded DNA struture is the result of A-hydrogen bonding…
A: The stability of DNA means that the double-stranded helix through which the DNA is made would…
Q: Make up your own DNA palindrome, of at least 6 bases long.
A: PALINDROME: The word 'palindrome' symbolizes number, phrase and sequence of characters…
Q: Variable number of tandem repeats (VNTRs) in the DNA molecule are highly useful in.......
A: Solution - Variable number of tandem repeats (VNTRs) in the DNA molecule are highly useful in DNA…
Q: The sequence of the 15 bp fragment from the previous problem is repeated below: 5' TCTGAATTCCGTAGA…
A: DNA is a double-stranded molecule that is made of several nitrogen base pairs. The nitrogen base of…
Q: Segment of DNA SGCTAACCTGATCGCCGGTATT 3'CGATTGGACTAGCGGCCATAAS 3' 1. Transcribe and translate the…
A: The change in nucleotide is called a mutation. it could be a point mutation when one nucleotide is…
Q: DNA sequences in which multiple copies are arranged nextto each other are called…
A: Repetitive sequences are the DNA fragments that are present in multiple copies within a genome.…
Q: Write the complementary sequence of DNA AGCTAT AGC
A: A DNA is a double stranded structure. Both the strands are complementary to each other. Adenine (A)…
Q: Find self-complementary regions in the following RNA sequence: AUGUGGCAUGCCAGG
A: Biomolecules includes carbohydrates, lipids, nucleic acids and proteins. Nucleic acid plays an…
Q: Discuss the importance of the discovery of the double helical structure of the DNA.
A: DNA is the genetic material in most organisms. It is the larges biomolecule in the cell. It is…
Q: Shown are several single stranded DNA sequences written in the 5' to 3' direction. Which of the…
A: A hair pin structure will be formed due to internal base pairing in a DNA molecule.
Q: For the DNA structure below write the correct base sequence in the form: 5-АТСТ-3 3'-TAGA-5 Make…
A: DNA or deoxyribonucleotide is the genetic material that is present in the higher organisms like…
Q: Why do DNA chips often contain segments derived from cDNA rather than genomic DNA segments?
A: DNA chip used in microarray
Q: Why is it important that the correct reading frame is used?
A: DNA contains both coding and non-coding region where introns are non-coding regions and exons are…
Q: The enzyme thiouridylase converts certain tRNA uridine residues to 2-thiouridine. Draw the structure…
A: Enzyme is a catalytic molecule that increases the rate of any chemical reaction without being used…
Q: Given this sequence ATGCACCG About how often (every _____ bases) would this occur in double strand…
A: All DNA strands are made up of nucleotides namely Adenine (A), Thymine (T), Guanine (G), and…
Q: Discuss the role of the hydrophobic interactions in stabilizing the following. Q.) Double-stranded…
A: DNA is a double stranded helical molecule that is made up of repeating nucleotides. The nucleotides…
Q: In Figure 1-8b, can you tell if the number of hydrogenbonds between adenine and thymine is the same…
A: DNA (Deoxyribonucleic acid ) the building blocks of DNA are the Nucleotides Nucleotides are made up…
Q: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written…
A: The DNA has two strands one is the Template strand and other is the coding strand. Based on the…
Q: DNA contents of nitrogenous bases • %A = %T %C = %G • A+G = C+T %3D Example: if 35% of the bases of…
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Q: Given the following eukaryotic DNA strand, transcribe and translate the DNA into a polypeptide using…
A: First a coding strand forms its complementary template strand during replication. Then m RNA is…
Q: Any RNA polymerase in any organism: OA Synthesizes RNA chains in the 3' to-5 direction O B. Binds…
A: A gene is a functioning heredity unit made up of DNA that provides instructions for the creation of…
Q: . Some naturally occurring polynucleotide sequences are palindromic; that is, they are…
A: The palindromic sequence is the DNA or RNA sequence that has the same sequence in complementary…
Q: Below is the sequence of a single strand of a short DNAmolecule. On a piece of paper, rewrite this…
A: Cells are the most fundamental and essential unit of life in all living things. All of life's…
Q: replication, resulting in a (e) Errors may change to the sequence of base triplets. Explain how a…
A: Ans- Errors that arise during the DNA replication because of the change in sequence of gene triplets…
Q: pppApCpCpUpApGpApU-OH(a) Using the straight-chain sugar convention, write the structure of the DNA…
A: DNA (deoxyribonucleic acid), as well as RNA (ribonucleic acid) both, are the genetic material in the…
Q: Genetics Attached is a segment of DNA (doublestranded). Answer the following questions about the…
A: Open reading frame is a part of genetic material which is responsible for expressing itself in the…
Q: The complementarity of its two strands is the underlying reason that DNA can be faithfully copied.…
A: DNA replication is a process in which two DNA molecules are synthesized from a single DNA molecule.…
Q: Nucleosome structure: Identify the proteins indicated by the arrow. Hint: there are two of these…
A: option -a)histone H2A-H2B diner is correct.
Q: Below is a sequence of DNA.…
A: Introduction Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide chains that coil…
Q: Variable number tandem repeats (VNTRs) are repeating DNA sequences of about 15–100 bp in length,…
A: Forensic science. Criminological science is the use of science to criminal and common laws,…
Q: Given the following eukaryotic DNA strand, transcribe and translate the DNA into a polypeptide using…
A: Protein synthesis from a gene consists in eukaryotes consist of three major steps: Transcription: It…
Q: AAGTCAAGAAGAAGAAGAAGCC A. The nucleotide sequence above is a STR of how many repeats? B. What…
A: Short Tandem Repeats(STR) or microsatellites or simple sequence repeats(SSR) are short sequences of…
Q: Name 3 structural features of the DNA and how they help the DNA perform its functions
A: DNA is made up of four nitrogenous encode bases adenine ,guanine ,cytosine and thymine. These four…
DNA Structure
Provide a detailed (hand-drawn) structure of the double-stranded DNA GGATCC
Step by step
Solved in 3 steps with 2 images
- Given the following eukaryotic DNA strand, transcribe and translate the DNA into a polypeptide using the 3’ – 5’ strand as the template. You may use drawings, diagrams, colours and annotations to describe how the DNA strand will be synthesized into a functional protein 5’ - TATAAAAASSMSBMDATGSBDCCMBDBAATBSMDSTGTGTCCTMSBAG – 3’ (KEY: The letters SBMD are “made up” nucleic acids that depict non-coding regions in the DNA, hypothetically S pairs with B and M pairs with D).What are the complete complementary bases of the parent DNA strand according to Chargaffs rule and Identify the names of all the genetic codes5’ TAAGCGTAACCCGCTAA CGTATGCGAAC GGGTCCTATTAACGCAC 3’ 3’ ATTCGCATTGGGCGATT GCATACGCTTG CCCAGGATAATTGCGTG 5’ Imagine that the double-stranded DNA molecule shown above was broken at the sites indicated by spaces in the sequence and that before the breaks were repaired the DNA fragment between the breaks was reversed. What would be the base sequence of the repaired molecule? Show the sequence, label the 5’ and 3’ ends and briefly explain the reasoning supporting your answer
- A DNA-binding protein recognizes the following double-strandedsequence:5′–GCCCGGGC–3′3′–CGGGCCCG–5′This type of double-stranded structure could also occur withinthe stem region of an RNA stem-loop. Discuss the structural differencesbetween RNA and DNA that might prevent the DNAbindingprotein from recognizing a double-stranded RNA molecule.Describe in detail the semi Conservative replication of the DNA double helix structureGiven the following eukaryotic DNA strand, transcribe and translate the DNA into a polypeptide using the 3’ – 5’ strand as the template. use drawings, diagrams, colours and annotations to describe how the DNA strand will be synthesized into a functional protein. 5’ - TATAAAAASSMSBMDATGSBDCCMBDBAATBSMDSTGTGTCCTMSBAG – 3’ (KEY: The letters SBMD are “made up” nucleic acids that depict non-coding regions in the DNA, hypothetically S pairs with B and M pairs with D).
- pppApCpCpUpApGpApU-OH(a) Using the straight-chain sugar convention, write the structure of the DNA strand that encoded this short stretch of RNA.(b) Using the simplest convention for representing the DNA base sequence, write the structure of the nontemplate DNA strand.Z-DNA derives its name from the zig-zag conformation ofphosphate groups. What features of the DNA molecule allowthis distinctive structure to form?Would you expect to find nuclear localization sequences(NLSs) in the proteins that make up prokaryotic and eukaryotic DNA and RNA polymerases? Explain why orwhy not