Draw a schematic of translation. Include the following: • 5'and 3'of MRNA nucleic acid • N and C of peptide • A, P, E sites • The MRNA should be AUGCACUACAUU • There should be a peptide bond formed between the first two amino acids but that's it. Codon s Fou d in
Q: During the termination of translation, what is the correct polypeptide sequence which will be…
A: DNA is the storehouse of genetic information. This information age expect by the formation of an…
Q: Translation begins at the start codon upstream from the start codon downstream from…
A: Translation refers to the process of polymerisation of amino acids to form a polypeptide. The order…
Q: Translate the following RNA sequence by using the genetic below. Start at the beginning of the…
A: Protein is made up of a chain of monomeric subunits called amino acids joined together by peptide…
Q: A template strand in bacterial DNA has the following base sequence: 5′ –AGGTTTAACGTGCAT–3′ What…
A: Bacterial DNA is contained within the bacterial chromosome along with several RNA and protein…
Q: List the sequences of the mRNA molecules transcribed from thefollowing template DNA sequences:a. T G…
A: The sequence of DNA that consists of genetic information is transcribed into RNA. The sequence…
Q: 70. Which of the following codes for the stop codon in mRNA? A.UUC B.UGA C.AUG D.AAA
A: Answer B) UGA
Q: 21a. Fill in the blanks to label each type of molecule in this figure. asp a.TRNA b.amino acids leu…
A: The synthesis of proteins takes two steps: transcription and translation. Transcription takes the…
Q: Explain the process translation. A complete answer will include the words below tRNA, amino acid,…
A: The translation is the process of amino acid change of protein synthesis from the mRNA sequence. The…
Q: Which amino acid sequence will be generated during translation from the following small mRNA:…
A: According to the hint given then the start codon is AUG (Met) The stop codon is UGA .
Q: Which of the following are stages of translation? Select all that apply.
A: Translation is the cycle where ribosomes in the cytoplasm or endoplasmic reticulum integrate…
Q: Consider this list (below) of steps involved in translation. These steps are out of order.…
A: Translation is the process by which ribosomes in the cytoplasm or endoplasmic reticulum generate…
Q: Consider a template strand of DNA with the following sequence: 3 '–CAA TGT ATT TTT GCT–5 '. (a) What…
A: Gene expression is the process by which the instructions in our DNA are converted into a functional…
Q: 9. Examine the image to the right, which represents a snapshot of translation. Which staan of…
A: Translation is the process of making proteins from RNA. Transcription is the process of making RNA…
Q: Draw a schematic of translation. Include the following: • 5'and 3'of MRNA nucleic acid • N and C of…
A: Translation is a process of making polypeptide chain, that is protein synthesis. Translation takes…
Q: The figure below shows a ribosome in the process of translating an mRNA with the sequence:…
A: Codon refers to a sequence of three nucleotides, which codes for start signal, stop signal for…
Q: The figure below shows a ribosome in the process of translating an mRNA with the sequence:…
A: The wobble hypothesis is tells that a single tRNA can recognize more than one codon. This is occurs…
Q: On the mRNA codon table below, the first nucleotide in mRNA is to the left, the second is above, and…
A: The DNA is transcribed into mRNA by the process of transcription and this mRNA is translated into…
Q: What polypeptides would be formed from the sequence UCAATGGGGUUUAUAGCG… (there are bases after the…
A: Ribonucleic acid (RNA) is a nucleic acid found in both the nucleus and cytoplasm. It can be genetic…
Q: Which of the following base pairings are allowed between an anticodon and the 3' base of a codon,…
A: According to wobble hypothesis, the third nucleotide of anticodon is a wobble and can base pair with…
Q: Which of the following best describes the initiation of translation? A. The mRNA binds the large…
A:
Q: Describe in Your own words the Termination step of Translation process
A: Proteins are polypeptide molecules synthesized by the translation of mRNA in the ribosome.…
Q: Assume the first nucleotide in the sequence is at the +1 position. Transcribe the DNA sequence into…
A: Deoxyribonucleic acid is the genetic material found within a cell's nucleus. Before cell division,…
Q: Which of the following nucleotide triplets best represents a codon?
A: Introduction:- A codon is a triplet of bases (or nucleotides) in the DNA coding for one amino acid.…
Q: A silent mutation is a mutation in which: a. one nucleotide in a codon is changed, but the codon…
A: Mutations are a sudden change in the nucleotide sequence of a gene that alters the amino acids and…
Q: A mRNA strand is 5’ to 3 across the translation initiation complex. The start codon is ____ And…
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Q: 3. On the diagram below, draw how the mRNA is translated into a peptide beginning with the third…
A: This question we have to describe about process of translation.
Q: Transcribe the following DNA strand into mRNA and translate that strand into a polypeptide chain,…
A: Transcription is the process by which RNA is synthesized from DNA. The genetic material is…
Q: Arrange the following components of translation in the approximate order in which they would appear…
A: Translation is the process of synthesis of proteins from the mRNA using special type of RNA called…
Q: Arrange the following steps in correct sequence. Translation 1. Formation of the peptide bond 2.…
A: The nucleotide is the most fundamental component of nucleic acids. The polymers RNA and DNA are made…
Q: START CODON STOP CODON 3' MRNA 5' UGAUCAU GAUCUCGUAAGAUAUC Met Ile Ser) STOP Polypeptide 1. Why do…
A: DNA is the genetic material that is present in almost all the organisms except for the viruses that…
Q: translation
A:
Q: The figure below shows a ribosome in the process of translating an mRNA with a sequence:…
A: Translation is a process in which a single stranded RNA sequence formed at the end of transcription…
Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…
A: The amino acids are coded by the group of three bases called base triplets and codons.
Q: Describe the key steps of translation, indicating howeach depends on the ribosome.
A: The central dogma of biology explains the flow of information from genes to protein by two…
Q: UAG CUA UCA AAU AGA, what tRNA anticodons would be needed to translate the sequence?
A: RNA- It stand for the ribonucleic acid. is a nucleic acid present in all living cells and in some…
Q: Transcribe and translate the following sequence of DNA: ATGAAGTTACCC. There is a mutation that…
A: Transcription is the synthesis of pRNA with the template DNA. Translation is the synthesis of…
Q: Codon to be read in the mRNA is 5' GAA 3', what is the amino acid? a. E b. K c.F d.L
A: Dear student answer of your question is given below: Given codon in the mRNA is 5' GAA 3' , It…
Q: Refer to the codon diagram on. Which of the following is a codon that will terminate translation? *…
A: The process of formation of a polypeptide sequence from an mRNA transcript is known as translation.…
Q: The following DNA strand is bound to transcription and translation. Give the translated 5-letter…
A: The nucleic acid polymer has nucleotide as its monomeric unit. synthesis of nucleotide…
Q: UCAAUGGGGUUUAUAGCG… (there are bases after the last G but we don’t know what they are so there may…
A: Ribonucleic acid (RNA) is a nucleic acid found in both the nucleus and cytoplasm. It can be genetic…
Q: The images shown depict the initiation and elongation steps in protein translation. Arrange the…
A: The amount of mRNA which is define with the mechanism that is usually produced by a gene is limited,…
Q: Translation is the process by which the sets of 3 bases (codons) of the MRNA are read to specify the…
A: The translation is a process through which the mRNA gets translated into polypeptide chains. The…
Q: Here is an mRNA sequence (written 5' → 3') A G G G A G G U A A C A G 14 15 16 17 18 19 20 21 24 27…
A: The translation initiation codon is the 5'-AUG-3'. From this codon the first amino acid is…
Q: Select the CORRECT sequence of sites that are involved in translation. A site, P site, E site E…
A: Translation is the process by which mRNA is used in the synthesis of a protein. Protein synthesis…
Q: ction of a Gene AAG ATA CAG GCT CGG TAA For the DNA sequence shown above, identify the following:…
A: AAG ATA CAG GCT CGG TAA : DNA
Q: Write the order of nucleotides in mRNA that would be transcribed from the following strand of DNA:…
A: 1. DNA- GTATACCAGTCATTTGTC mRNA- CAU AUG GUC AGU AAA CAG Amino acids - His- Met-Val-Ser-Lys-Gln
Q: 40.The mRNA codon for methionine is the start codon in eukarvotes. What is the corresponding three…
A: The start codon is the sequence of three nucleotides present on mRNA that is responsible for the…
Q: A single base substitution mutation is likely to have a less harmful effect when the base change…
A: A single base substitution mutation is also known as the point mutation which changes a single base…
Q: Gene 1 TACTTGTTTACATAACTTTGAATT Step 1. Transcribe the DNA to MRNA Step 2. Draw lines to separate…
A: Genes are known as the hereditary units of life. They encode different proteins that are utilized to…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 1 images
- Write the sequence of the mRNA molecule synthesized from a DNA template strand having the sequence 5'-ATTACAGGCGGT-3' 5'- UAAUGUCCGCCA Incorrect Write the amino acid sequence encoded by the mRNA base sequence 5'-GAGUUAGUUUGUAAGUGC-3' Assume the reading frame starts at the 5' end. Refer to the codon table . Amino acid sequence: Glu-Leu-Val-Cys-Lys-Cys What is the sequence of the polypeptide formed on addition of poly(UUAC) to a cell-free protein-synthesizing system that does not require a start codon? Enter an amino acid sequence of four amino acids using the three-letter abbreviations. Polypeptide sequence: Poly( -3' Glu-Leu-Val-Cys-Lys-CysUCAAUGGGGUUUAUAGCG… (there are bases after the last G but we don’t know what they are so there may be some ambiguity for the last codon with regards to the amino acid possibilities) if the translation frame had UCA as the first codon: if the translation frame had CAA as the first codon: if the translation frame had AAT as the first codon:An mRNA transcript is listed below and contains both start and termination codons. Assume that the initial methionine will stay on the polypeptide in this case. What amino acid sequence will be specified during translation? List the amino acids. The start codon is highlighted. 5’ – CAGCCAAGCAUGCUCGCAAAUGGACGUUGAUAUUUUGUC – 3’
- 8. The following diagram illustrates a step in the process of translation. fMet Pro mRNA UAC GGG AUGCCCACG UAG a) Identify the following elements on the diagram. Aminoacyl site (A) Peptidyl site (P) Exit site (E) Amino end of the newly synthesized polypeptide chain Carboxyl end of the newly synthesized polypeptide chain Approximate location of the next peptide bond that will be formedAn RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP and GTP. When this RNA is used in an in vitro translation system, all of the following amino acids could be incorporated into a newly made polypeptide, except: Codon Table Second position A G UUU UCU UAU UGU phe tyr сys UUC UCC UAC UGC ser UAA Stop UGA Stop A UAG Stop UGG trp UUA UCA UUG UCG CUU CCU CAU CGU leu ССС pro his CAC CUC CGC arg CỦA ССА CAA CGA gln CUG CCG CAG CGG AUU ACU AAU AGU asi se ACC thr ACA AUC ile AAC AGC AUA AAA lys AAG AGA arg AUG met ACG AGG GUU GCU GAU GGU asp GGC gly GGA GUC GCC ala GCA GAC val GUA GAA glu GAG GUG GCG GGG proline (pro) histidine (His) O arginine (Arg) alanine (Ala) glycine (Gly) Third position (3'-end) First position (5'-end)5’ AUG UUA CGU AAU GCU GUC GAA UCU AUU UGC UUU ACA UAA 3' Write the sequence of the DNA template (antisense) strand from which the mRNA was synthesized. Write the sequence of the DNA coding (sense or informational) strand complementary to the template strand. Write the sequence of tRNA anticodon that corresponds to the given mRNA molecule. Write the amino acid sequence of the peptide synthesized from the given mRNA nucleotide sequence.
- An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP and GTP. When this RNA is used in an in vitro translation system, all of the following amino acids could be incorporated into a newly made polypeptide, except: Codon Table Second position C UUU UCU UAU UGU phe tyr сys UUC UCC UAC UGC ser UAA Stop UGA Stop UAG Stop UGG trp UUA UCA UUG UCG CUU CCU CAU CGU leu his ССС pro ССА CỤC САС CGC arg CỦA САА CGA gln CUG CCG CAG CGG AUU ACU AAU AGU asn ser AUC ile ACC thr АCА AAC AGC AUA AAA lys AAG AGA arg AUG met ACG AGG GUU GCU GAU GGU asp GUC GCC ala GCA GẠC GGC val gly GUA GAA GGA glu GUG GCG GAG GGG glycine (Gly) histidine (His) proline (pro) alanine (Ala) arginine (Arg) Third position (3'-end) AGUCAG First position (5'-end)Given the following codons and their corresponding amino acids: UUU-Phenylalanine GAA- Glutamate CAA- Glutamine AAU- Asparagine AAC- Asn AAA- Lysine UCU- Serine GGA-Glycine ACC-Threonine AUG- Met/ START codon CCU- Proline GUU- Valine UAU-Tyrosine UAA- STOP AGG- Arginine AUU- Isoleucine CAU- Histidine GCU- Alanine UGU-Cysteir GAU-Asparti CUA-Leucine UGG-Tryptol CGU-Arginin Box 1: Show the mRNA sequence which codes for the short peptide, lys-ala-phe- leu. Include what should come before and after this short message. Don't leave any spaces between the letters. Box 2: Show the tRNA anticodon sequence that would line up with the mRNA strand from Box 1. Don't leave any spaces between the letters. Box 3 & 4: Show the DNA base sequence that would be found in the DNA double helix which carries the gene for this peptide. Give the coding strand sequence in Box 3 and template strand sequence in Box 4. Don't leave any spaces between the letters. Box 5: What if there was a frameshift at leucine…Consider the following DNA template: 5’-AAGAGGTTCCAATGCAGGCACTCACCAACTCTTAAATAAA-3’ 3’-TTCTCCAAGGTTACGTCCGTGAGTGGTTGAGAATTTATTT-5’ If the bottom DNA strand is used as template to transcribe mRNA, predict the amino acid sequence that would result from the process of translation. Met-Ala-Leu-Thr-Gln-Glu-Gly Met-Gly-Ser-Leu-Asn-Ser-Gln Met-Thr-Asn-Ser-Leu-Ala-Gln Met-Gln-Ala-Leu-Thr-Asn-Ser Met-Glu-Ala-His-Trp-Ser-Tyr
- Refer to the information on the genetic code. Use this information to determine how many amino acids are coded for by the mRNA sequence AUGCGCAGUCGGUAG. The genetic code Second letter of codon UAU UAC JUU Phenylalanine uCU UUC Phe) UUA Leucine (Leu) UUG Tyrosine (Tyr) GCysteine (Cys) UGC 1oStop codon |UGG Tryptophan (Trp) CGU CGC UcC Serine (Ser) UCA ucc CCU cC Proline (Pro) Stop codon UAG Stop codon CAU Histidine His) CU CUC CUA CUG Arginine (Arg) Leucine (Leu) cca CAA CCA CGA Glutamine (Gin) CAG AUU AUC AUA ACU Isoleucine (le) AAU AAC AGU AGC Asparagine (Asn) Serine (Ser) ACC Threonine (Thr) ACA Methicnine ACC start codon GCU Lysine (Lys) AGA Arginine (Arg) ARC AGS GAU Aspartic acid (Asp)G0 GAC GUU GUC Valine (Val) GCC Alanine (Ab) GG Glycine (Gly GUA GUG GCA GCG GA Glutamic acid (Glu) GA GGG GAG 4 15 First letter of codon Third letter of codonWhat polypeptides would be formed from the sequence UCAATGGGGUUUAUAGCG… (there are bases after the last G but we don’t know what they are so there may be some ambiguity for the last codon with regards to the amino acid possibilities) if the translation frame had UCA as the first codon: if the translation frame had CAA as the first codon: if the translation frame had AAT as the first codon:An mRNA transcript has the following complete sequence: 5'-AUGCCUACGUUACGGACC-3' Rewrite the sequence to give it a missense mutation. Circle/highlight the mutation. Explain how your specific mutation would affect the formation and structure of the 2nd (middle) Base of a Codon 1st U CA G 3rd Base Base UUU Phe UUC Phe UUA Leu UUG Leu UCU Phe UCC Phe UCA Leu UCG Leu UAU Tyr UAC Tyr UAA STOP UAG STOP UGU Cys UGC Cys UGA STOP UGG Trp protein. U CUU Leu CUC Leu CUA Leu CUG Leu CCU Pro ССС Pro CCA Pro CCG Pro CAU His CAC His CAA Gln CAG Gln CGU Arg CGC Arg CGA Arg CGG Arg AGU Ser AGC Ser AGA Arg AGG Arg AAU Asn AAC Asn AUU lle AUC lle AUA lle AUG Met ACU Thr ACC Thr ACA Thr ACG Thr A AAA Lys AAG Lys GUU Val GUC Val GUA Val GUG Val GCU Ala GCC Ala GCA Ala GCG Ala GAU Asp GAC Asp GAA Glu GAG Glu GGU Gly GGC Gly GGA Gly GGG Gly UCAG