Answered: During activities between 1 and 2.5…

During activities between 1 and 2.5 hrs, including team sports, ____________ is recommended. Group of answer choices 30-60 g CHO/hr 70-90 g CHO/hr a CHO mouth rinse no CHO intake

Principles Of Pharmacology Med Assist

6th Edition

ISBN:9781337512442

Author:RICE

Publisher:RICE

Chapter8: Forms Of Drugs And How They Act

Section: Chapter Questions

Problem 19RQ

See similar textbooks

Related questions

Q: why are the color and consistency of cooked meat different than that of raw meat? a.) the…

A: The term "meat" refers to the flesh portions of animals used for nourishment. Such portions comprise…

Q: Which of the following is NOT a function of the cytoskeleton? Group of answer choices Helps…

A: Introduction The cytoskeleton is a dynamic network of protein filaments and tubules. It is found in…

Q: Ch. 5: Which of the following is FALSE about tuberculosis? a) it is caused by a bacterial infection…

A: Introduction A contagious infectious bacterial disease having its main target area as the lungs. The…

Q: 5: Asthma is best described as:

A: Asthma is a medical condition related to difficulty in breathing, based on its triggers it can be…

Q: Explain how tropisms and hormones work to help plants survive changes in their environment

A: Plants are members of the kingdom Plantae. They are multicellular eukaryotes, capable of carrying…

Q: Which of the following terms is not associated with te cell membrane of animal cells? a.) protein…

A: In order to create hydrophilic tunnels through the membrane, channel proteins bridge it, allowing…

Q: Explain how the ovum of a plant is fertilized.

A: Male and female gametes (reproductive cells) are joined during plant fertilizations to create a…

Q: B-cells participate in _______ immunity and produce ________ a. acquired, proteasome…

A: Immunity mediated by humor is mediated by B lymphocytes. The B cell transforms into a plasma cell,…

Q: Oocytes contain inactivated ______ that become activated soon fertilization. The mechanism that…

A: An essential step at the beginning of embryo development during fertilization is oocyte activation.…

Q: Which of the following are associated with the autonomic nervous system? L O both parasympathetic…

A: The peripheral nervous system's autonomic nervous system controls physiological functions that are…

Q: h. 5: All of the following are true about cystic fibrosis EXCEPT: a) it affects a membrane calcium…

A: Introduction Cystic fibrosis refers to a chronic and serious genetic disorder or condition that…

Q: Does a positive, negative, neutral, or zero ΔG associate with cellular facilitated transport?

A: ANSWER) Facilitated transport is the passive method of transport which is generally spontaneous and…

Q: Contraction of sarcomeres is dependent upon the motor protein attached to and moving along

A: The germ layer, mesoderm, is the source of soft tissue called muscles. Connective tissue is…

Q: . Explain the processes involved in providing energy during long-term starvation. . Describe how the…

A: Starvation is process which happens if someone don't eat for some days or weeks. And the body…

Q: T-cell receptor diversity is controlled by Select one: DNA recombination during prophase of meiosis…

A: T cells are the lymphocytes involved in adaptive immune responses. These cells have receptors for…

Q: Fast block to polyspermy is achieved by a. exocytosis Ob. actin polymerization Oc. action potential…

A: Polyspermy is the fertilisation of an egg with more than one sperm. “Poly” means many and “spermy”…

Q: What prevents the lakes of colder parts of the world from freezing solid from bottom up? Water in…

A: Warm water generally gets more dense as it gets colder, and therefore sinks. This fact may lead you…

Q: Ch. 5: Atelectasis could be caused by which of the following?: a) the presence of air in the pleural…

A: Introduction : The collapse or closure of a lung, which results in minimal or no gas exchange, is…

Q: Ch. 8: Which of the following is NOT a benign condition of the reproductive system a) mastitis b)…

A: Among the given options, the correct answer can be identified as follows- C) Uterine cancer Here,…

Q: A mutation in the Ras protein could directly affect improper _____ Select one: a. cell signaling…

A: Ras protein Ras is a family of proteins that are expressed in all animal cells and organs. Ras…

Q: alle 19 14. An organism which is positive for the CAMP test must be a(n) a. Group A Streptococci b.…

A: According to the question 14, Option (c) - Group B streptococci is the CORRECT answer. CAMP test is…

Q: The illustration below shows a process that occurs during meiosis. paired homologous chromosomes An…

A: Meosis is a process in which number of chromosomes reduced to half. It is usually occurs during the…

Q: Chloroplasts and mitochondria require protein import because Select one: O a. these organelles have…

A: It takes two different genetic systems—one in the organelle and one in the cell nucleus—to…

Q: Which of the following are characteristics that distinguish cancer cells from normal cells? Check…

A: Introduction Normal cells divide, grow and die. Cancer cells lack the property of contact inhibition…

Q: Organisms can use a variety of carbon and energy sources, depending on their availability in the…

A: Metabolic processes are the processes takes place inside the living organisms in which larger…

Q: Ch. 6: The major buffering system of the extracellular fluid (ECF) is: a) the bicarbonate-carbonic…

A: Introduction Buffer is the solution that resists the change in pH when an acidic solution or a basic…

Q: EFFECTS OF OSMOSIS Osmosis is the diffusion of water across a semipermeable membrane from an area of…

A: Introduction: the process by which solvent molecules move through a semipermeable barrier from a…

Q: 29. Correctly label each image below with the ELISA method it is describing (3pts) Ag Ampan…

A: Introduction:- ELISA is a plate based assay technique designed for detecting and quantifying soluble…

Q: Consider the sequence below for amplification: GGCGTAGGCTGATCGTGGGCTCTAGGGGGCTGCTGCTGCTATTATGCTGGC…

A: The polymerase chain reaction (PCR) is a molecular biology technique to amplify a DNA segment of…

Q: cell? What has to happen to it? 2. Do mutations that cause cancer in an individual pass down to the…

A: Cancer occurs when the cell divides uncontrollably to form a lump called tumor. It may occur due to…

Q: 4.3. Calculate the carbon dioxide volume expired during one hour by person performing the physical…

A: ANSWER) Volume of air expired in one expiration is 500mL. Number of breaths in one minute in normal…

Q: Fast block to polyspermy is achieved by: Select one: O a. a. membrane depolarization O b. action…

A: Polyspermy is the process in which multiple sperms can enter into the egg. This is normal in many…

Q: certain cells in the pancreas of animals produce and secrete insulin. Which of the following…

A: Insulin is a peptide hormone which is made in the beta cells of Islets of Langerhans of pancreas. It…

Q: A. what cyclic pathway does this common metabolite enter? B. what are the reduced forms of NAD+ and…

A: Introduction:- Cellular respiration is a metabolic process in which oxidation of organic compounds…

Q: In mammals , the evolution/ development of the organs of the digestive system is closely related to…

A: All of these specialisations are connected to digestive system development. Because the stomach was…

Q: The vp test looks for products of fermentation

A: Biochemical tests utilize the specific characteristics of bacteria to identify them accurately. Some…

Q: Which of the following plates (dilution factor) would you count/use to determine the original…

A: Dilution factor is a measure of the decrease in concentration of a solution that occurs in a…

Q: We now have at least three SARS-CoV-2/COVID-19 vaccines approved by the FDA for use in the United…

A: The vaccines are: 1. Pfizer-BioNTech – Authorized on December 11, 2020 2. Moderna – Authorized on…

Q: Keratin is a type of found in the cytosol, which means its hydrophobic amino acids are Select one:…

A: Keratin is a type of protein that is also known as scleroprotein. This protein is present in hairs.…

Q: What is Genomics?

A: Genomics is defined as the study of organism's complete set of genetic information. It is a branch…

Q: If you map two different organims daily movements, and see these types of patterns, answer the…

A: Navigation is a way of finding the direction of a particular path by sensing environmental…

Q: A molecule has a very high Km. This molecule is most likely _____________ Select one: a. a storage…

A: The concentration of substrate at which the reaction reaches half of its maximum velocity is known…

Q: describe the steps of a lytic infection typical to a dna virus like herpes simplex virus. in simple…

A: A virus is an obligate parasite with DNA or RNA as genetic material. The genetic material can be…

Q: More... I Assume that the intrinsic rate of growth is 0.75 for mosquitoes (Family: Culicidae). If…

A: As the first question is incomplete, we will be able to provide answer to the second question only.…

Q: Ch. 7: When a sphincter of the bladder is weakened, this could lead to: a) reflex incontinence b)…

A: The muscles needed to control urine, such as the pelvic floor muscles and the urethral sphincter,…

Q: The overall goal of chemiosmosis is to make ________ in the __________. Select one: a. NADH, Kreb’s…

A: Chemiosmosis takes place in the mitochondria during respiration and in the chloroplasts during…

Q: 9) Which of the following is not a chemical buffer system? A) bicarbonate B) phosphate C) protein D)…

A: Introduction: The buffer mechanisms in the human body are incredibly effective, and they operate at…

Q: apply the knowledge of the structure and function of the eye and the ear to understand the sensory…

A: The specialised organs known as sensory organs, which are made up of sensory neurons, enable us to…

Q: Please complete the table below. asap Types of hemodynamics Definition Causes Example 1.…

A: All these diseases are blood disorders. Hemodynamics measures cardiovascular functions related to…

Q: Introduce imaging methods to visualise healthy and diseased cells and tissues

A: Nov invasive imaging of internal organs is termed biomedical imaging. It allows examination ad…

Concept explainers

Nutrition and diet

We are involved in several daily activities. These actions need a significant quantity of energy. The food we eat provides this energy. Food is necessary for development, repair, and other living activities since it supplies energy. All of these are part of the living practice known as nutrition. Nutrition is the study of nutrients in food, how the body uses them, and the relationship between diet, health, and disease. Nutritionists employ concepts from molecular biology, biochemistry, and genetics to understand how nutrients affect the human body. Nutrition also looks at how people can use their diet to reduce their risk of disease, as well as what happens when they ingest too much or too little of a nutrient and how allergies emerge.

Question

During activities between 1 and 2.5 hrs, including team sports, ____________ is recommended.

Group of answer choices

30-60 g CHO/hr

70-90 g CHO/hr

a CHO mouth rinse

no CHO intake

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

The physician has ordered ibuprofen for pain 6mg/kg/dose. The infant weighs 15.4 pounds. How many mg of ibuprofen will you give per dose? ______mg.
I want answer with explanation and within 1.5Hr.
The nurse gives the patient formula feeding of 240 mL at 0800 and 1200 followed by 50 mL of water after each feeding. At 1400, the nurse gives an additional 50 mL of water through the feeding tube. Calculate the total intake for the shift in milliliters. Enter the numeral only (not the unit of measurement) in your answer. ___mL
Please answer all the given items will give you thumbs up and good rating. Analyze the validity of the given statement. Choose True if the statement is correct and False if otherwise. 1. Carbohydrate linked to proteins in the cell membrane provides energy in the form of glucose possesses HC=O linked to lipids in hormones contains C=O 2. Enzyme-Substrate Complex hyaluronidase and semen salivary α-amylase and lactose pancreatic amylase and maltose hexokinase and glucose salivary α-amylase and cellobiose
Undigested food leaves the sea star through the ________________________
inNisa Kuy-Blood Glucose Graph Annotations - 17680788 ✩ Edit View Insert Format Slide Arrange Tools Extensions Help Accessibility Q- Y A MY 91- Background Blood Glucose Graph og C Y 11 Layout Theme Transition 213 Last edit was 5 hours ago 31. 41 SAFL bl. sends signals to the pancreas then secretes another hormone, glucose that has been stored in the liver. As extra glucose levels increase again. Blood glucose glucose 114 5 O L brain M Revise your initial response from Slide 5 using information from the TEXT. How do blood glucose levels INCREASE in the body? Blood glucose levels increase when food is broken down by the digestive system. Glucose is absorbed into the bloodstream from the intestine. When levels are low, a part of the called the which slows or stops the release of glucose. The Glucagon instructs the liver to release the extra is released into the bloodstream, blood glucagon Submit Assignment 617 pancreas Revise your initial response from Slide 5 using information from the…
Use the Medical Dictionary (Merriam-Webster Online – posted in WEEK 1 folder), to look up each term main entry – give main entry (pronunciation) and definition for each term. Also, listen to pronunciation of the terms using the dictionary. EXAMPLE TERM Main Entry (pronunciation) Meaning Нурerglycemia hy-per-gly-ce-mia excess of sugar in blood Medical Term Main Entry (Pronunciation of DEFINITION term) (Meaning of term) 1. trigone 2. anuria 3. oliguria 4. ureterocele 5. hemodialysis 6. nephrolithotomy 7. albuminuria 8. nephrosclerosis 9. lithotripsy edema 11. cystoscopy 12. polydipsia
Give typing answer with explanation and conclusion The physician prescribed medication G 0.6 g, orally, every 12 hours. The medication label reads medication G 100 mg per 5 ml. The nurse should prepare how many ml to administer the dose? Convert the answer to fluid ounce. _______ fl oz
Order: Medication A is to be given 1.2 g per day in four divided doses The nurse will administer _____ mg per dose.
The healthcare provider dilutes morphine 2 mg and so that the concentration is 2 mg/5 mL. The medication is to infuse over 2 minutes. The medication will be administered at a rate of _____mL/min. write units in your answer.
A Moving to another question will save this response. Question 14 Doctor ordered Tab. Valium (Diazepam) 5mg HS for Ms. S on the night prior to surgery. This is to O reduce pharyngeal secretion minimize the dose of anesthesia prevent nausea and vomiting relieve anxiety and enhance rest
A Moving to another question will save this response. Question 9 "The Nurse would advise the client, to hold his breath for 10 seconds after pressing the Ventolin Metered dose inhalers (MDI) in order to, O allow medication to spread in the throat O prevent mucosal irritation O prevent adverse reaction O allow the aerosol to reach the deeper airways A Moving to another question will save this response. Skyworth