Q: A biotech lab technician is working with a mutated form of a particular bacterial gene and wants to…
A: Plasmids are naturally occurring extra chromosomal double standard DNA molecules that replicate…
Q: Describe two features that are characteristic of the action of restriction endonucleases. How do…
A: Restriction endonucleases are found in almost every prokaryotic organism. The primary biological…
Q: How does DNA cloning in a plasmid vector permits amplification of a DNA fragment.
A: Molecular cloning or cloning is a technique to assemble DNA of two different organisms and directing…
Q: Bacterial plasmids often serve as cloning vectors. Describe the essential features of a plasmid…
A: Plasmids are the carriers of the genes that are primarily used in biotechnology. Plasmids are the…
Q: How is Ti plasmid of Agrobacterium tumefaciens modified to convert it into a cloning vector?
A: Agrobacterium tumefaciens is a well-studied species of the gram-negative genus of bacteria, known as…
Q: What are the features of a plasmid being used as a cloning vector?
A: Some Features of a plasmid which have been used as a cloning vector are: Selectable markers…
Q: Why is cDNA used for cloning?
A: Cloning is the production of organisms, which are genetically identical to their parents. These…
Q: which is the delivery techniques can bbe used to best transfer recombinant plasmids into E.coli…
A: ANSWER) The process of transferring the recombinant plasmids into the E.coli cells is called…
Q: If the size of the of a pDrive cloning vector is 3,850 bp and a mecA PCR product is inserted into…
A: Genetic engineering (GE) is the intentional change of an organism's genetic structure, which…
Q: Describe the process of cloning a DNA fragment into the BamHI and PstI sites of the vector pUC18.…
A: A cloning vector is a DNA molecule used as a vehicle to artificially carry foreign genetic material…
Q: What are transgenic Bacteria? Illustrate using any one example?
A: Genetic engineering is the modification of an organism’s genome for a beneficial outcome. Bacteria,…
Q: Why is ligase needed to make recombinant DNA? Whatwould be the immediate consequence in the cloning…
A: DNA replication is the process of copying the DNA of the cell during cell division. DNA ligase is an…
Q: c) Describe how plasmid PBR322 is used as a cloning vector. What are their special features? d) What…
A: Bacteria have extra chromosome apart from genomic chromosome . This extra chromosomal part have…
Q: Your cloning vector has restriction recognition sites for two restriction endonucleases, EcorI and…
A: Introduction Recombinant DNA technology enables us to construct DNA using the Recombination method.…
Q: Compare and discuss the key features of plasmids that are respectively used as bacterial cloning and…
A: Plasmids are extrachromosomal , double stranded DNA molecules which are capable of autonomously…
Q: What is blue/white screening? What is the key feature of a plasmid that is used for it?
A: The blue-white screen is a screening technique that allows for the rapid and convenient detection of…
Q: Describe the process of cloning a DNA fragment into the EcoR1and AluI sites of the vector pUC18. How…
A: DNA cloning is characterized as a cycle of creating different duplicates of a specific DNA. This…
Q: With reference to the image below, discuss the process and principle involved for…
A: Molecular cloning or cloning is a technique to assemble DNA of two different organisms and directing…
Q: How the Sequencing Technologies Have Progressed Rapidly ? Explain about this ?
A: Early efforts at sequencing genes ere troublesome, when Gilbert and Maxam reported the sequence of…
Q: When using a conventional plasmid cloning vector containing a b-galactosidase gene, it is possible…
A: The blue–white screen is a techinque that allows for the rapid and convenient detection of…
Q: Explain why recipient cells do not successfully takeup plasmids during natural transformation.
A: The alternation of genetic material of cell that results from direct uptake and incorporation of…
Q: How does restriction enzyme digestion allow for the determination of the correct plasmid construct…
A: Restriction enzymes are proteins that cut DNA at specific sequences. These enzymes are found in…
Q: Briefly describe two different methods for inserting foreign DNA into plasmids, giving the strengths…
A: The plasmid is typically a small circular deoxyribonucleic acid (DNA) strand in the cytoplasm of the…
Q: which parts would a plasmid vector with 2500 bp have in E. coli
A: A plasmid is a small, circular, double-stranded DNA molecule that is distinct from a cell's…
Q: a. What is the size of the PCMV plasmid? b. What is the size of the Fuzz gene? c. How many EcoRI…
A: Hello. Since your question has multiple sub-parts, we will solve first three sub-parts for you. If…
Q: The Ti plasmid, is often used for making transgenic plants. Where the plasmid is found?
A: Bacteria are microorganism that most commonly occur in the soil, air, water and in adverse…
Q: the role (presence and absence) of a selectable marker (selection) in cloning a recombinant DNA…
A:
Q: In an attempt to clone a gene into the TOL plasmid, it was observed that the restriction product of…
A: Restriction Enzymes or “Restriction endonucleases” are proteins that cut DNA at a specific base…
Q: Explain the limitation of DNA microarrays ?
A: DNA microarray is the molecular laboratory technique that helps in studying and measuring the…
Q: In regards to using PCR: Explain why a plasmid is often engineered with tetR and lacZ. What purpose…
A: Plasmids are employed in genetic engineering to amplify, or duplicate, certain genes. Plasmids are…
Q: Describe the molecular features of a BAC cloning vector. What is theprimary advantage of a BAC…
A: Cloning is defined as the process of formation of the individuals possessing identical DNA. This…
Q: Explain how to identify mutant genes molecularly bytransformation with recombinant plasmids.
A: Recombinant plasmids can be created by inserting desired DNA fragments or genes into a plasmid…
Q: Why choose vectors and plasmids as a method of module introduction/expression?
A: Introduction Plasmid Vectors: these are like the artificial vehicle to deliver our gene of insert…
Q: When constructing a Recombinant DNA Plasmid intended to be transformed into E. Coli, why is a…
A: Recombinant DNA plasmids are molecular tools which are utilized to deliver foreign gene into a…
Q: Explain how you would utilize the lacZ gene in your plasmid to confirm successful recombinant…
A: DNA cloning is the process in which multiple, identical copies of a selected fragment of DNA is…
Q: What is the Ti plasmid and how is it modified for the genetic modification of plants?
A: Plasmids are circular and extrachromosomal DNA (sometimes RNA) present in prokaryotic as well as…
Q: Identify mutant genes by plasmid library transformation?
A: A plasmid is a small extrachromosomal circular DNA molecule found in bacteria. Transformation is the…
Q: Why do we need a plasmid to transform a bacteria? What are the essential components of a plasmid…
A: Recombinant technology is one of the major and most useful applications of biotechnology. It…
Q: If you use the pUC18 vector to clone in the MCS region, predict the following: a) Do bacteria that…
A: pUC18 [plasmid of the University of California], is a bacterial plasmid that was derived from pBR…
Q: Will you please help me in understanding these? How many fragments will be formed after…
A: "Since you have asked multiple questions, we will solve the first three questions for you. If you…
Q: Explain why rolling circle replication of plasmids is semi-conservative.
A: The process of making the copy of DNA is termed as DNA replication. There are three methods for the…
Q: Why are antibiotic resistance genes usually included in plasmids used for genetic transformation?
A: Bacterial transformation is the process of transferring the genetic material from one bacterium to…
Q: Based on the knowledge you gained from the cloning module, which of the bands in the figure is…
A: Cloning modules allows you to have more control over which parts of the original module are…
Q: a. What is the purpose of molecular cloning?b. What purpose do selectable markers serve in…
A: Plasmids are small, circular extrachromosomal DNA present in a cell. These extrachromosomal…
Q: A. What would be the donor organism to be used in this cloning? B. How would you make sure you only…
A: E.coli WA802 strain could be used as a donor organism in cloning pKY plasmid as it is compatible…
Q: What are some potential difficulties in using plasmid vectors and bacterial host cells to produce…
A: Recombinant DNA technology involves integrating DNA molecules from two different species and…
Q: With the use of well-illustrated diagrams, reconstruct the entire cloning process by explaining…
A: Molecular cloning or cloning is a technique to assemble DNA of two different organisms and directing…
Q: use a NanoDrop spectrophotometer to analyze plasmid DNA obtained from miniprep. What information…
A: A spectrophotometer is a device that measures the amount of light a solution has absorbed in order…
Step by step
Solved in 4 steps
- Besides PUC vectors, there are still other plasmid vectors in the market such as pBR327 and pZERO®-1. Some vectors are designed specifically for TA cloning while some are not. What is TA cloning? Explain in detail. Give two (2) examples of plasmid vectors that can undergo TA cloning. (i) (ii)The plasmids from the pUC series are created in the University of California. They carry a lacz gene that plays a significant role in the screening process after transformation. (i) Name the screening process utilizing the lacZ gene. (ii) Elaborate how this gene plays a crucial role in the screening step as mentioned above.After transformation you were asked to grow bacterial cells transformed with plasmid on a plate that had X-gal and ampicillin. X-Gal is often used as in indicator dye, which turns blue when metabolized by B-galactosidase protein and used to test if cloning experiments have worked. [Note look at the vector diagrams carefully] Briefly explain how you would find the bacterial cells that are transformed with the plasmid with the YFG inserted.
- Besides the pUC series, there are other plasmid vectors in the market such as pBR327 and pGEM-T. Some vectors are designed specifically for TA cloning while some are not. What is TA cloning? Explain in detail.Bacterial plasmids often serve as cloning vectors. Describe the essential features of a plasmid vector.Many resistance mechanisms are encoded on plasmids. These mechanisms are of great clinical significance, because they can spread very easily through horizontal gene transfer. A culture of the bacterial isolate is grown, and plasmid DNA is isolated using a spin column-based solid phase extraction method. The purified plasmid DNA is then submitted for next-generation sequencing. Bioinformatic analyses of the sequencing results suggests that the following gene is likely involved in antibiotic resistance: > putative antibiotic resistance gene ATGCGTGTATTAGCCTTATCGGCTGTGTTTTTGGTGGCATCGATT ATCGGAATGCCTGCGGTAGCAAAGGAATGGCAAGAAAACAAAAGT TGGAATGCTCACTTTACTGAACATAAATCACAGGGCGTAGTTGTG CTCTGGAATGAGAATAAGCAGCAAGGATTTACCAATAATCTTAAA CGGGCGAACCAAGCATTTTTACCCGCATCTAGTGCGAAAATTCCC AATAGCTTGATCGCCCTCGATTTGGGCGTGGTTAAGGATGAACAC CAAGTCTTTAAGTGGGATGGACAGACGCGCGATATCGCCACTTGG AATCGCGATCATAATCTAATCACCGCGATGAAATATTCAGTTGTG CCTGTTTATCAAGAATTTGCCCGCCAAATTGGCGAGGCACGTATG…
- Find a plasmid map for pET11a and create a basic procedure for cloning a gene into this vector. Which selection method and substance would you use for this plasmid after transformation?A plasmid that is both ampicillin and tetracyclineresistant is cleaved with PstI, which cleaves within theampicillin resistance gene. The cut plasmid is ligated withPstI-digested Drosophila DNA to prepare a genomic library,and the mixture is used to transform E. coli K12. Question: How can you explain the presence of colonies thatare resistant to both antibiotics?A shuttle vector is a vector (usually a plasmid) constructed so that it can propagate in two different host species. One of the most common types of shuttle vectors is the yeast shuttle vector. Examples of such vectors derived from yeast are Yeast Episomal Plasmid (YEP), Yeast Integrating Plasmid (YIP) and Yeast Replicating Plasmid (YRP). Why is YEP preferred over YIP and YRP? Give your thoughts on this.
- Alu 1 EcoRI ori pKY Bgl I Tet: Tetracycline resistance gene A. What would be the donor organism to be used in this cloning? B. How would you make sure you only get your gene of interest (EGF) from donor but nothing else? C. How do you put EGF gene into pKY plasmid? What is the best RE to use when inserting the gene into pKY plasmid? What happens if you use the enzyme Bgl I to insert the gene of interest? How does it affect your cloning result? D. How do you make sure you only grow E.coli that have the gene of interest?Using the plasmid map of pBCH2.0 provided above, predict how many DNA fragments would be formed if this plasmid was digested with restriction enzyme BamHI.As this is a non-directional cloning, recombinant plasmids can contain an insert ligated into the vector in two different orientations. Provide 2 diagrams to illustrate the 2 potential recombinant plasmids, with the inserts ligated in opposite orientations. Include all RE sites and distances between sites on the diagram.