For each of the following sequences, rank them in order (from best to worst) as sequences that could be used to initiate translation according to Kozak’s rules. GACGCCAUGG GCCUCCAUGC GCCAUCAAGG GCCACCAUGG

For each of the following sequences, rank them in order (from best to worst) as sequences that could be used to initiate translation according to Kozak’s rules. GACGCCAUGG GCCUCCAUGC GCCAUCAAGG GCCACCAUGG

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1ITD: Below is a sequence of 540 bases from a genome. What information would you use to find the...

See similar textbooks

Related questions

Q: A microbiologist discovers a new type II restriction endonuclease. When DNA is digested by this…

A: Restriction enzymes are also known as molecular scissors because they cut the DNA at specific, short…

Q: Translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the first…

A: The deoxyribonucleic acid (DNA) is the hereditary material that transmits the genetic information…

Q: What are eukaryotic translation initiation factors (eIFs)

A: Answer- Translation is the process of formation of polypeptide from the mRNA sequence.

Q: Assume the following portion of an mRNA. Find a start signal, and write the amino acid sequence that…

A: The sequence of protein is usually notated as a string of letters, according to the order of the…

Q: The template strand of a double helical segment of DNA consists of the following sequence:…

A: Introduction: DNA is a type of nucleic acid that is present in the nucleus of the cell. It is a…

Q: Considering prokaryotes, what is the enzyme that links the tRNA molecules to its correct or cognate…

A: Ans- tRNA molecules serves as the link between the amino acid form of proteins and the genetic code…

Q: Suppose the codon sequence GCCAUUCAAGCGGAU has a single base pair mutation to GCCAUUCAAACgGAU. If…

A: DNA replication being very complex process, there are chances of miss reading the DNA template and…

Q: What is the estimated speed of translation of human? Please give reasonable explaining and provide…

A: The translation is the process of protein synthesis which occurs in the ribosomes. It takes place…

Q: The difference between prokaryotic and eukaryotic protein initiation is that eukaryotes' initiator…

A: Translation is the process of Synthesis of proteins from amino acids by peptide bond formation. It…

Q: Consider the following 2 codons sequences. Codon sequence 1: ACU AGA GAU GUC UGC Codon sequence…

A: β-sheets are formed by adjacent parallel or antiparallel peptide strands that are hydrogen bonded in…

Q: What is the difference between eukaryotes and prokaryotes in terms of translation initiation?

A: Translation is the process of synthesis of the peptide chain through specific codons present on the…

Q: If the sequence of mRNA is 5'-AAUCGUACGGAUGCCGAAAUACCCAUUAGGGAUUGCAUAGCGAGCAACGGAC-3', what is the…

A: Protein is the final product of a gene that determine the phenotype of the organism. Protein…

Q: Given the following mismatch (highlighted in red), which base will be replaced after mismatch repair…

A: Normal metabolic activities and environmental exposure can cause DNA damage. DNA damage in human…

Q: Where does translation occur in this diagram

A: Translation is the process by which messenger rna is getting translated into proteins .

Q: What is the consensus sequence of the following six DNA…

A: DNA or the Deoxyribonucleic acid present in both eukaryotes and prokaryotes are made up of millions…

Q: Translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the second…

A: The mRNA (messenger ribonucleic acid) is synthesized from a DNA (deoxyribonucleic acid) template.…

Q: If there are 64 possible codons in the genetic code and the amino acid is specified by each, as read…

A: Protein synthesis is described as the process that ultimately results in the formation of proteins.…

Q: Choose the combination of answers that most accurately completes the statement.Which of the…

A: Restriction endonuclease or restriction enzyme is a type of enzyme used in cloning studies. It is…

Q: codon usage bias

A: ᴍᴜᴛᴀᴛɪᴏɴ ɪꜱ ᴅᴇꜰɪɴᴇᴅ ᴀꜱ ᴀ ᴄʜᴀɴɢᴇ ɪɴ ᴛʜᴇ ɴᴜᴄʟᴇᴏᴛɪᴅᴇ ꜱᴇQᴜᴇɴᴄᴇ ᴏꜰ ᴀ ɢᴇɴᴇ ᴏʀ ᴀ ᴄʜʀᴏᴍᴏꜱᴏᴍᴇ. ᴡʜᴇɴ ᴏɴʟʏ ᴏɴᴇ…

Q: For translation, identify two things that happen during each step - initiation, elongation and…

A: Translation is a complex process it is the final formation of protein with the help of m RNA, t RNA…

Q: Ôn the space provided, type the translation product of wild-type gene A (use three- letter…

Q: A normal hemoglobin protein has a glutamic acid at position 6; in sickle-cell hemoglobin, this…

A: In the normal hemoglobin molecule protein, has a glutamic acid (an amino acid) at the sixth position…

Q: How many possible open reading frames (frameswithout stop codons) exist that extend through the…

A: In molecular genetics, an open reading frame (ORF) is the part of a reading frame that has the…

Q: Find self-complementary regions in the following RNA sequence: AUGUGGCAUGCCAGG

A: Biomolecules includes carbohydrates, lipids, nucleic acids and proteins. Nucleic acid plays an…

Q: In prokaryotic protein synthesis, formylmethionine (fmet) is the first amino acid incorporated,…

A: Methionine which is a central molecule in one-carbon metabolism is an essential amino acid needed…

Q: Given Sequence: 3’ – TACGGACTGATAGGCCCGCGCATC-5’ PLEASE PROVIDE THE RANSLATION OF THE FOLLOWING:…

A: The template strand is from 3` 5` and a coding strand of DNA is from 5` to 3`. The synthesis of m…

Q: Is N-formyl-methionine used to start translation in eukaryotes? Yes No

A: Translation is the process in which ribosomes synthesize proteins after the process of transcription…

Q: Why can translation in prokaryotes begin before transcription ends?

A: Prokaryotes are single-celled organisms. They consist of the domains Bacteria and Achaea. The…

Q: The following enzyme has an exact integer number of turns. What is the length and amount of amino…

A: Enzyme are usually composed of proteins while some enzymes are ribozymes (RNA enzymes). Proteins are…

Q: Which of the following amino acids is carried by the tRNA that initiates translation in eukaryotes?…

A: Transfer RNA or tRNA is an adapter molecule, which plays an essential role in decoding the sequence…

Q: Identify the dinucleotide CA repeat region and the score in the following sequence:…

A: Nucleotide is defined as the basic block of DNA and RNA that also known as building block of it.

Q: What polypeptide sequences would you expect to result from a synthetic mRNA with the repeating…

A: The messenger RNA (mRNA) is a molecule produced during the process of transcription where the enzyme…

Q: The template strand of a double helical segment of DNA consists of the following sequence:…

A: DNA is first transcribed into messenger RNA and then mRNA is translated into protein sequence.

Q: What specific roles do translation factors play in both prokaryotic and eukaryotic translation…

A: In eukaryotes, transcription and translation takes place in different cellular compartments:…

Q: Given the following sequence of a coding DNA strand: AGTTGCGCATGCCAGAGAGGTTCGAGTGCACATAACTTGAG The…

A: DNA is a double stranded molecule with coding strand and template strand. Template strand is the one…

Q: Why can translation begin before transcription is complete in prokaryotes, but not eukaryotes?

A: Transcription and translation are two different processes that are essential for cellular…

Q: What feature of eukaryotic translation is especially responsible for its efficiency?

A: Genetics is the investigation of heredity. Heredity is a natural interaction whereby a parent passes…

Q: A standard codon table such as the one that we looked at in class gives the following information:

A: Three types of RNA interact to synthesize proteins. They are mRNA, tRNA, and rRNA.mRNA is the…

Q: What is the order of the polypeptide chain shown in the images provided? Starting at the…

A: Translation is the process of synthesizing proteins from RNA template through series of reactions on…

Q: The template strand of a double helical segment of DNA consists of the following sequence:…

A: Translation is the mechanism by which ribosomes in the cytoplasm or endoplasmic reticulum…

Q: . The following synthetic polynucleotide is synthesized and used as a template for peptide synthesis…

A: Polypeptide is made up of chain of amino acids linked together. Polypeptides are connected together…

Q: Consider the following DNA template: 5’-AAGAGGTTCCAATGCAGGCACTCACCAACTCTTAAATAAA-3’…

A: Of the two strands of DNA, the template strand or non-coding strand is used for transcribing an mRNA…

Q: Use the codon table to determine one possible DNA sequence that corresponds to the following amino…

A: A sequence of three consecutive nucleotides in a DNA or RNA molecule that codes for a specific amino…

Q: two differences and 2 similarities between prokaryotic and eukaryotic translation initiation

Q: The template strand of a double helical segment of DNA consists of the following sequence:…

A: DNA is composed of nucleotides and it is a double-stranded helical molecule, and each of nucleotide…

Q: T-A-C |А - А - G А - т-G G-G-G А -т-т DNA enter answer - enter answer enter answer - enter answer…

A: DNA mRNA TAC AUG AAG UUC ATG UAC GGG CCC ATT UAA

Q: Why is it necessary for an in silico translation tool to provide 6 different frames of the…

A: The open reading frame or the ORF is the gene region that can get translated by the translational…

Q: What increases the efficiency of translation initiation in eukaryotes ?

A: The biological process by which messenger RNA is translated into proteins in eukaryotes is known as…

Concept explainers

Genomics

Genes are responsible for transmitting the characters located on the chromosomes from one individual to another across the generations. Genetics is the study of different genes that are involved in different functions. Genetics is a branch of biology that studies genes, genetic diversity, and heredity in living organisms. The genetic system consists of genetic notations, which is a system of signs and symbols. Genotype refers to the organism's genetic composition, and phenotype refers to the observable property of the organism.

Question

For each of the following sequences, rank them in order (from best to worst) as sequences that could be used to initiate translation according to Kozak’s rules.

GACGCCAUGG

GCCUCCAUGC

GCCAUCAAGG

GCCACCAUGG

Expert Solution

Introduction

DNA is the genetic material that carries genetic information in the form of coded nucleotide sequences. This information in the DNA is transcribed into single stranded mRNA, from which target proteins are synthesized by translation.

Step by step

Solved in 2 steps

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

For the following sequence please design an 18 base pair REVERSE primer. ATGGCTGATAAGATAGAGAGGCATACTTTCAAGGTCTTCAATCAAGATTTCGAAAAAGAGCTGGAGTTTGGATTAGATAGAAAATATTTTTAG
Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’- GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ By in vitro translating the mRNA, you determined that the translated peptide is 15 amino acids long. What is the expected peptide sequence in single letter abbreviations?
Translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the first base: 5’ - UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU - 3’
Suppose the codon sequence GUGCAAUUCGAGGCC has a single base pair mutation to GUGCAAUUCAAGGCC. If the old protein sequence was Val-Gln-Phe-Glu-Ala, what will be the new sequence encoded by the mutant gene? ____________________________.
In the human genome for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotide in the amino acid coding region is represented by the sequence 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5'
In the copies of each sequence below, divide the sequences into codons (triplets) by putting a slash between each group of three bases. Sequence ATCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGCCGCCAGGGCCCCGCCCCTCAGAAGTTGGTSequence BTCAGACGTTTTTGCCCCGTAACAACTTGTTACAACATGGTCATAAACGTCAGAGATGGTCAATCTCTTAATGACTSequence CTACAAACATGTAAACACACCCTCAGTGGACCAACTCCGCAACATAAACCAAACACCGCTCGCGCCGAAAAAGATATGG
The following RNA sequence represents a small messenger which can be translated in a prokaryotic cell: 5'-ACGAAUGCACAGUAAAACUGGCUAGCGUAGGCUGA-3 Assume that the messenger RNA is translated in the cell, using the correct machinery and signals required for accurate protein synthesis. Using this RNA sequence and the Genetic Code Dictionary (see your textbook for the dictionary), solve the following problems A. Write the sequence of a protein that would be translated from this mRNA, using the appropriate stop and start signals, and indicating the correct termini of the protein product. B. Suppose that the underlined A in the sequence is changed to a U. Write the expected protein product of this mRNA.
Translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the second base: 5’ - UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU - 3’
For the following sequence please design an 18 base pair forward primer. ATGGCTGATAAGATAGAGAGGCATACTTTCAAGGTCTTCAATCAAGATTTCGAAAAAGAGCTGGAGTTTGGATTAGATAGAAAATATTTTTAG
Using the genetic code table provided below, write out the sequence of three different possible mRNA sequences that could encode the following sequence of amino acids: Met-Phe-Cys-Trp-Glu C A G U C UUU Phe UCU Ser UUC Phe UCC Ser UCA Ser UUA Leu UUG Leu UCG Ser CUU Leu CCU Pro CUC Leu CUA Leu CUG Leu CCG A CAU His CGU Arg CCC Pro CAC His CGC Arg UAU Tyr UGU Cys U UAC Tyr UGC Cys C Stop UGA Stop Stop UGG Trp UAA A UAG G CCA Pro CAA Gln Pro CAG AUU lle AUC lle AUA lle AUG Met ACG G 등등 Gln CGA Arg CGG Arg ACU Thr AAU Asn AGU Ser ACC AAC Asn AGC Ser Thr ACA Thr Thr AAA Lys AGA Arg AAG Lys AGG Arg GUU Val GCU Ala GAU Asp GGU Gly GGC Gly GUC Val GCC Ala GAC Asp GUA Val GCA Ala GAA Glu GGA Gly GUG Val GCG Ala GAG Glu GGG Gly U C A G U C A G SUAU
Using the genetic code table provided below, identify the open reading frame in this mRNA sequence, and write out the encoded 9 amino acid long peptide sequence: 5'- CGACAUGCCUAAAAUCAUGCCAUGGAGGGGGUAACCUUUU C A G U UUU Phe UCU Ser UUC Phe UCC Ser UAC UCA Ser UAA UCG Ser UAG UUA Leu Leu G C CUU Leu CUC Leu CCC CUA Leu CUG Leu AUU lle AUC lle AUA lle AUG Met ACG ACU Thr ACC Thr ACA Thr Thr A UAU Tyr UGU Cys Tyr UGC Cys CCU Pro CAU His CGU Arg Pro CAC His Pro CAA Gln CGC Arg CGA Arg CCA CCG Pro CAG Gln CGG Arg GUU Val GCU Ala GAU GUC Val GCC Ala GAC GUA Val GCA Ala GAA GUG Val GCG Ala GAG Stop UGA Stop UGG AAU Asn AAC AAA AAG AGU Asn AGC G Lys Lys Asp Asp Glu Glu Stop A Trp Ser Ser AGA Arg AGG Arg GGU Gly GGC Gly UCAG GGA Gly GGG Gly с U C A G U C A G U C A G
For the following sequence, what is the Tm? 5'-AGCTACGATCAGGTCA-3'