From an extract of human cell growing in tissue culture, A fibrous substance was obtained. How would you distinguish whether it was DNA or RNA?
Q: 5. Since in this patient pyruvate kinase is abnormal not only is less pyruvate made but…
A: The RBCs are the cells which carry oxygen to various tissues. The RBCs yield energy from the…
Q: What is the detection principle of iodine test for starch
A: The iodine test is a quantitative analysis of carbohydrates to distinguish polysaccharides from…
Q: A positive result for the Ninhydrin test yields a deep blue or violet-blue color of the soluti more…
A: Ninhydrin test is a chemical test performed to detect the presence of amines or amino acids.
Q: Millon's test is used to detect the amino acid, tyrosine. However, to solely use the qualitative…
A: The amino acid tyrosine has a phenolic group in its side chain.
Q: What diseases are the related protein deficiency in the human body? Explain their rationale.
A: Protein deficiency occurs in the human body when the body does not get enough amount of protein that…
Q: 3. A 2-year-old child was taken to the hospital. His mother said that he vomited frequently,…
A: The inborn error in metabolism occur due to mutation in a gene of the metabolic pathway.
Q: ). Isoniazid (MAO inhibitor) is prescribed to the patient with Parkinson discase. What does cause…
A: Parkinson's disease: A long term degenerative disorder of central nervous system.
Q: 6. An organic substance bound to an enzyme and essential for its cavity is called: a. coenzyme b.…
A: Enzymes are proteins that involved in metabolic function by speeding up the chemical reaction.
Q: The sucrose substitute tagatose is produced by hydrolyzing lactose and then chemically converting…
A: Introduction: Tagatose is a ketohexose that appears similar in structure to D-fructose, except for…
Q: Which statement about gluconeogenesis is FALSE? Group of answer choices For starting materials, it…
A: Gluconeogenesis is the biochemical pathway by which pyruvate is converted into glucose.
Q: Please explain how did this reaction happened.
A: Molisch's test is a qualitative test used to detect the presence of carbohydrate in a sample. In the…
Q: Write the metabolism (phase 1 & phase 2) of Phenoxybenzamin
A: Phenoxybenzamine is an alpha-adrenergic antagonist with long duration of action because of longer…
Q: Explain the process and main pathways of steroid hormones synthesis in relation to cholesterol…
A: Steroid hormones are lipid molecules that are produced in the ovary, testis, placenta, and adrenal…
Q: Describe the reaction and the products that would occur if transketolase acred upon a pentose aldose…
A: Transketolase is an enzyme of pentose phosphate pathway which accept two carbon from pentose ketose…
Q: . Considering the following nucleotide sequence in an mRNA molecule: 5’ AUG UUA CGU AAU GCU GUC…
A: Since you have posted a question with multiple subparts, we will solve the first three subparts for…
Q: residues listed below: (a) Ser195 (b) His57 (c) NH groups of Gly193 and Ser195
A: Hi! Thank you for the question, as per the honor code, we are allowed to answer the first 3…
Q: 3. (а) 0.0050 M operate at one-quarter of its maximum rate? At what substrate concentration would an…
A: To study an enzyme kinetics, Michaelis-Menten kinetics equation is best known mathematical…
Q: In which of the following processes is glucose 6-phosphate the end product? Group of answer…
A: Glucose : Carbohydrate that serves as the major energy source for the body. Glucose-6-phosphate:…
Q: Match the items on the diagram with the correct term below. 3' 5' 5 D 8 Activate W DNA Replication…
A: DNA replication is the particular process by which a specific molecule of DNA is being duplicated.…
Q: BACKGROUND A 2-year-old black girl is being seen by the hematologist after her pediatrician found…
A: Due to the lack of mitochondria, there is no TCA cycle occurring in the RBCs. So, RBCs obtain the…
Q: Visceral fat loss is often associated with increased insulin sensitivity. Assuming that with the…
A: D. -10.6
Q: Indicate a positive result with a (+) sign, and a (-) if otherwise. A triple (+) may be used to…
A: Molisch’s test - is used to detect carbohydrates. Molisch test gives positive for all carbohydrates…
Q: 3. (а) 0.0050 M operate at one-quarter of its maximum rate? At what substrate concentration would an…
A: To study an enzyme kinetics, Michaelis-Menten kinetics equation is best known mathematical…
Q: In cholesterol, to which ring of the steroid system is the hydroxyl group attached? B O A
A: cholesterol is a sterol and is the primary compound from which synthesis of many steroid hormones,…
Q: Match the best possible fit for the following Animal virus replication stages. A. Attachment B.…
A: Viruses contain nucleic acid/ribonucleic acid in the core region while the exterior/…
Q: 1. What are processed foods?
A: “Since you have asked multiple question, we will solve the first question for you. If youwant any…
Q: 5. Protein tyrosine phosphatase-1B (PTP1B) is an important enzyme regulating insulin signaling be-…
A: PTP1B enzyme in question catalyze the hydrolysis of phosphorylated tyrosine on Insulin receptor and…
Q: (osgnthesis
A: Retrosynthesis is a breaking down of targeting molecule by the process of ''breaking down '' a…
Q: Protein denaturation is the disruption of a protein's secondary to quaternary structures. Protein…
A: Denaturation is a process in which proteins or nucleic acids lose their native quaternary, tertiary,…
Q: The polypeptide chains in insulin are held together by hydrogen bonds Group of answer choices True…
A: Insulin is a protein made up of two polypeptide chains designated as A (21 amino acids residues) and…
Q: What are the control mechanisms of glycolysis and the Krebs cycle.
A: The question is all about the process involve in respiration like glycolysis and kreb cycle in which…
Q: Morphine (give structure) and enkephelin (give structure) both are antagonists of the m opioid…
A: An antagonist is a particular drug that blocks opioids by attaching to the specific opioid receptors…
Q: 3. A 2-year-old child was taken to the hospital. His mother said that he vomited frequently,…
A: Mutations in enzymes of the metabolic pathways are called inborn errors in metabolism.
Q: What does protein function in the human body?
A: Proteins are made up of amino acids or we can say that amino acids are the building block of…
Q: Which of the following are possible responses to a membrane receptor being activated? O activating…
A: Membrane receptors are protein molecules with specialized functions. Membrane receptors are either…
Q: HbA1c is used to monitor blood glucose levels because hemoglobin is the only protein in blood that…
A: “Since you have asked multiple question, we will solve the first question for you. If youwant any…
Q: What other diseases are associated with estraneous forms of hemoglobin subunits in the human adult?
A: Hemoglobin is an oligomeric conjugated protein with four peptide chains joined by a…
Q: In which of the following pairs Is the first eleme than the second? (1 Point) O 0, P O Cs, Rb O I,…
A: Electronegativity - It is property of an atom in a molecule. The tendency of an atom to attract the…
Q: calculate the volume of stock solutions required to make up the buffer solutions that will be used…
A: Introduction: A buffer solution is a solution that changes pH slightly with the addition of a strong…
Q: What is the final enzyme used in the biosynthesis of stearate (C18:0)? A. Elongase B.Beta-Ketoacyl-…
A: Fatty acid biosynthesis occurs in the cytoplasm of the cell. Fatty acids are the long-chain…
Q: Question 6 Match the following lipids with their functions v Bile acids A. signaling molecules…
A: Lipids are biomolecules that include fats, waxes, oils, hormones, and certain components of…
Q: Three [BIOMOLECULES] Instructions; — Answer the questions properly. — Do not copy in Google or…
A: Fatty acids are hydrocarbon chains with a carboxylic acid group. Fatty acids are classified as…
Q: 1.A:Identify the three major chemical buffers of the body B : Choose one and describe the operation…
A: Hi! Thank you for the question, as per the honor code, we are allowed to answer the first…
Q: Why some of the dissolved plant matter travels faster with the alcohol up the filter paper than the…
A: Answer: Ethanol has high eluting nature, and also has higher viscosity through which it can travel…
Q: Question 4 Match the following descriptions to the given choices v Synthesized from a steroid…
A: A vitamin is an organic molecule which is an essential micronutrient for organism and are needed…
Q: Sample Results Remarks Glycine A Methionine B Egg albumin
A: Lead sulphide test is a specific test for the detection of sulphur containing aminoacid like cystein…
Q: (Q39) A mutation in a certain protein results in the presence of a cysteine residue (rather than the…
A: Answer 39) A mutation is considered as a change in a DNA sequence. Mutations can easily result from…
Q: Using specific examples of receptor-ligand binding, compare and contrast cell signalling by G…
A: Receptors are proteins, which bind to a specific ligand and triggers signaling pathways inside the…
Q: Which metabolic pathway converts glucose into two molecules of pyruvate and ATP? Group of answer…
A:
Q: You receive a tube containing 18.8 nmol of lyophilized (freeze dried) primers to be used in PCR. How…
A: Primers are a short nucleic acid sequence that provides a starting point for DNA synthesis. I…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- TRUE OR FALSE a) The long solenoid structure of the chromatin material binds to a protein scaffold through the SARs or MARs in the DNA. b) There can be a quantitative determination of the degree of supercoiling in a DNA sample.A plasmid is a DNA double helix in which the ends of each of the strands of nucleotides are attached to each other, forming a circular DNA molecule. 1) True 2) FalseSince DNA is a hydrophillicmoelcule, it cannot pass through cell membranes. Name and explain the technique with which the DNA is forced into (ii) a bacterial cell (ii) a plant cell (iii) an animal cell.
- in the gel than a A DNA molecule that is 1000 base pairs in length would go molecule that is 200 base pairs in length. A) further B) you cannot tell from the information provided C) the same distance D) not as farEDTA weakens the cell wall by removing ions that help hold it together while glucose prevents premature cell lysis due to osmosis in cells with weakened cell walls. You have made a batch of resuspension solution to isolate plasmid DNA, but you forgot to add EDTA. What do you think will happen when you try to perform a plasmid isolation procedure with this reagent? Why?You have begun your career in medicinal biochemistry and have just discovered a bacterial DNA plasmld (transferabl ring of DNA) that appears to destroy the Ebola virus. In order to characterize your new plasmid, the molar mass of the plasmid must be determined. You dissolve 25.00 mg of the purified plasmid in 0.200 mL of water at 2 °C and find the osmotlc pressure of this solution is 1.20 Torr at 20 °C and 1 atm pressure. Answer the following about the Ebola-killing plasmid. 33.) The osmotlc pressure of the system is: (a) 1 atm (b) 0.016 atm (c) 6.5 X 10-5 atm (d) 22.59 atm (e) 0.0016 atm
- As you should recall, DNA, when not being actively transcribed, has a double helical structure. This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein. The following is one of the two complimentary strands of DNA: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template strand? ______________________________ Q: Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47: mRNA: ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___- polypeptide chain: ________--________--________--________--________--________--________--________A DNA strand was sequenced using the Sanger method (https://www.youtube.com/watch?v=KTstRrDTmWI). The reaction tube contained the DNA strand, fluorescently labelled dideoxynucleotide triphosphates (ddATP – yellow, ddGTP – green, ddCTP – blue, ddTTP - red), deoxynucleotide triphosphates, DNA polymerase, or its Klenow fragment. Synthesis of DNA is allowed to proceed, and the results are shown on the right: 15 14 13 12 11 10 (a) What is the sequence of the copy and the template strands? (b) If the template strand were in the 5'-3' direction, what will be the sequence of the DNA copy? Nucleotide LengthDNA molecules of different sizes are often separated with the use of a technique called electrophoresis . With this technique, DNA molecules are placed in a gel, an electrical current is applied to the gel, and the DNA molecules migrate toward the positive (+) pole of the current. What aspect of its structure causes a DNA molecule to migrate toward the positive pole?
- a) If you isolated DNA from the ear and the tail of the same mouse, would you expect the DNA, isolated from the two tissue types, to be the same? Why? b) Provide one difference between DNA replication in eukaryotes and prokaryotes with regard to their origin (s) of replication.Why was it necessary to mash the strawberries extensively with your hands? (hint: you wouldn’t have to do this step with an animal cells). Why do we treat the cells with soap when conducting DNA extraction? And why do we add salt when doing the DNA extraction?You want to digest 1 µg of plasmid DNA in a final volume of 50 μL. Your solution containing plasmid has a concentration of 25 ng/μL. How many μL of your plasmid solution do you need to add to your reaction tube to digest your desired mass of plasmid?