Gene therapy: a) what disease is it used for? b) what genetic defect causes the disease? c) what and how viral vector is used AND/OR CRISPR-Cas is used?
Q: Construct a schematic representation of the circulatory designs of the mentioned vertebrates which…
A: Here I will provide you schematic representations of snakes, birds, fish, frog, mammals and…
Q: a salad recipe calls for gelatin to be mixed with hot water and then canned pineapple. victoria…
A: This is due to an enzyme present in the pineapple. The enzyme name is bromelain and the details are…
Q: Reproduction is usually sexual with both male and female sexes, however asexual reproduction does…
A: Asexual and/or sexual reproduction are used by animals to make offspring. Both systems have benefits…
Q: What are MHC class I and class II receptors and how do they recognize foreignness? This is an…
A: MHC (Major Histocompatibility complex) is a type of transmembrane glycoprotein which are presented…
Q: Single strand invasion is promoted by Rad51 protein in Eukaryotes for repair of Double Strand…
A: Homologous recombination is the exchange of genetic material between two strands of DNA. It occurs…
Q: What is environmental science? Name several disciplinesthat environmental science draws upon.
A: The term 'environmental science' is a term which is referred to a grouping of scientific…
Q: 1. What are the target cells of SARS-CoV-2? What do these cells have in common?
A: Many scietific studies have confirmed that SARS-CoV-2's spike protein attaches to…
Q: A team of investigators is out on a boat on a lake on a marvelous,sunny summer day, and they are…
A: Introduction Ocean have totally different ecosystem as there are different factors that affect the…
Q: The species of the Galápagos Islands (a) are similar to those on other islands at the same latitude…
A: Scientists believe that all continents existed as a single landmass millions of years ago. Later, as…
Q: An epidemic may be detected by observing
A: Endemic is used to describe diseases that spreads rapidly to a large number of people of a given…
Q: Subject: Biopharmaceutical technology 1.Identify the types of water that are available and widely…
A: USP (US Pharmacopeia) is a designation that ensures that the water is purified and can be used in…
Q: In practice, what are the component parts of a GPC system and how they work together?
A: One of the most effective and diverse analysis tools for evaluating and forecasting polymer…
Q: A human disease example in which a dominant allele that is lethal in homozygous state is…
A: Solution Huntingon's disease is a non- sex linked dominant genetic trait which means males and…
Q: What is the basic principle of GPC (gel permeation chromatography)?
A: Gel permeation chromatography is a type of size-exclusion chromatography that uses organic solvents…
Q: Explain the single molecule of single-stranded DNA ?
A: DNA is the genetic substance which contains the genetic code of living things. The terms DNA and RNA…
Q: differentiate founder effect from bottleneck effect.
A: The two types of genetic drift are founder effect and bottleneck effect. Both, in the form of…
Q: Can the frequencies of all genotypes in a population be determined directly with respect to a locus…
A: The dominant allele causes a dominant phenotype in an individual and is composed of one copy of any…
Q: How do eukaryotic and prokaryotic RNA polymerases compare? Despite their added complexity,…
A: The general process of transcription can be applied to both prokaryotic cells and eukaryotic cells.…
Q: 6. Consider the following biochemical pathway: precursor compound I enzyme enzyme A В compound II…
A: The fungus Neurospora was used by Beadle and Tatum to manipulate the biochemical outcomes of…
Q: PROCEDURE 1 Time to Trace! In this procedure, you will be tracing two invaders: bacteria in the…
A: Bacteria are microscopic, single-celled organisms that exist in their millions, in every…
Q: Describe the nature and extent of genetic variation, including genetic polymorphism, balanced…
A: There are basically three types of genetic variation. These are: Single base-pair substitution –…
Q: Aromatase inhibitors are a new generation of drugs used to treatwomen who have estrogen-sensitive…
A: In 70% of the cases of breast tumor estrogens fuel the growth of a tumor. It stimulates the growth…
Q: Name 2 sources of variation produced during meiosis.
A: Meiosis is a form of cell division in which the reduction of the number of chromosomes to half…
Q: Assuming that both types of pom-poms are present in the population, what do you think would happen…
A: Effect on the pom-poms population if the black forest experienced a prolonged drought.
Q: if you know the amino acid sequence of a protein can you predict with 100% certainty the DNA…
A: Codon is the genetic code that is formed by permutations and combinations of three nucleotide…
Q: painful throat relapse after a few days.Discuss the possible reason for the relapse. Antibiotics are…
A: After two days he feels better, he save the rest of penicillin for later days, result is causes the…
Q: In the US, many farmers regularly use the herbicide glyphosate to keep their fields free from weeds.…
A: Weeds are unwanted plants that grow in fields of particular crops.
Q: Knockout mice are mice in which certain genes are rendered irreversibly nonfunctional through the…
A: The knockout mouse has been a valuable tool for geneticists to discern the role of a gene in…
Q: Provde real exmaples of Public health strategies and campains of the prevalence of diabetes.
A: Diabetes can be described as condition in which blood glucose or blood sugar, becomes too high in…
Q: Which group of animals have endoskeletons? Annelids and Mollusca Cnidaria and Ctenophora O Nematoda…
A: Endoskeleton is internal bone or cartilage structure of animals which have a vertebra and some…
Q: What are the pros and cons to Clementsian and Gleasonian views of plant communities. List one pro…
A: *Clementsian is an American plant ecologist in study of vegetation succession. * Clements theory…
Q: Cystic fibrosis is a recessive Mendelian disorder. An individual must have two copies of the…
A:
Q: 1. How do demographic factors affect population size? 2. Are the effects of these factors mutually…
A: Demography is the statistical and mathematical study of the size, composition, and spatial…
Q: How do studies of brain development in knockout mice support the statement that apoptosis is a…
A: Apotopsis is a process of programmed cell death. It is a process in which the cell division is…
Q: Which microevolutionary force typically changes genotype frequencies without changing allele…
A: The allele frequency shows the incidence of an allele or a gene variant in a population. Genotype…
Q: Which statement is NOT a key recommendation according to the current Dietary Guideline? Select one:…
A: Dietary guidelines provide advice on what to eat and drink for a healthy lifestyle. These help to…
Q: Explain how and why the queen honey bee abort the sexual maturation of the worker bees?
A: Queen bees have a specialised reproductive system , which lets them make some choices on the types…
Q: Complement can enhance phadocytosis because of the presence on macrophages and neutrophils of…
A: The correct option is C3b.
Q: Public health strategies on the prevalence of diabetes.
A: Diabetes is a chronic metabolic disease which needs proper care and attention to control it.
Q: Monarch Monarch Species A Species B 0.5 I O Nomal Warmer Normal Warmer Climate Figure 1. The…
A: As the temperature increases, that is as the climate becomes warmer the concentration of…
Q: b. What is the average charge of the amino acid at a pH of 10? Please round your answer to the…
A: The isoelectric point is the point at which amino acids carry no net charge.
Q: Which of the following is true about Liebig's Law of the Minimum? A. The growth of a plant is not…
A: Justus von Liebig popularised Liebig's law of the minimum, also known as Liebig's law or the law of…
Q: Summarrize the laws and policies that relate to the practice of agricultural and biosystems…
A: It was An Act Strengthening, Modernizing and Aligning the Practice of Agricultural Engineering in…
Q: 1. You are observing an unknown vertebrate whose limbs are probably vestigial. What are the possible…
A: A limb is a jointed appendage in humans and numerous different animals use for locomotion like…
Q: Which of the following is NOT true regarding the alternative complement pathway? It can be triggered…
A: There are three types of complement pathways: Classical pathway Alternative pathway Lectin pathway
Q: how much nuclear DNA in picograms is present in a skin cell during anaphase?
A: DNA is the genetic material present indide the nucleus of each of the cells in the eukaryotic body.…
Q: Describe the most significant hormones responsible for sex differentiation. List the most important…
A:
Q: In a population at genetic equilibrium, the frequency of the dominant phenotype is 0.96. What are…
A: Introduction :- The condition of an allele or genotype in a gene pool (such as a population) in…
Q: In Mendel's genetic experiments many characteristics of the plants were quantified, such as their…
A: Mendel uncovered the fundamental laws of heredity. His experiments demonstrated that the inheritance…
Q: On a separate sheet of paper. A. Classify the Value of Biodiversity: Give the value of each organism…
A: INTRODUCTION Biodiversity is referring to the diversity of living organisms that are interdependent…
Question:
Gene therapy:
a) what disease is it used for?
b) what genetic defect causes the disease?
c) what and how viral vector is used AND/OR CRISPR-Cas is used?
d) what is in the horizen re. development of new virus-based gene delivery vesicle?
Step by step
Solved in 2 steps
- 15) Why are viruses an ideal candidate for gene delivery in gene therapy? a) What are TWO limitations of viruses as gene delivery vectors in gene therapy?Given that viruses must be cultivated to make vaccines against viral diseases, discuss the advantages and disadvantages that might occur with each approach (embryonated egg versus cell culture) to growing animal viruses.4) List 3 things that a potential vector must have in order to be useful. 5) Sometimes the gene for the enzyme glutathione-S-transferase (GST) is used in purifying your protein of interest. Briefly explain how this is done. 6) What enzyme is used to create CDNA from MRNA?
- Q.No.4. A) Design a oligonucleotide probe for provided gene sequence using all the guidelines for efficient probe designing. ACAACCCCAAGCCTTCAACCACCCCCTTCCCCCAAATTAGAGATCGATCTCAAGAAGAAGAATGGGTTCCGTCTCTCGCTCTTCTTTGGATCAGAAGCTGGCCATGGCAAAGCGCTGCTCCCACGAGGGAGTTGTCGCGGGAGCAAAGGCGGCCGTGGTTGCAACTGTTGCCTCGGCCATTCCTACTTTGGCTAGCGTTAGGATGATCCCATGGGCGAGGTCCTTCCTTAATCCCGCAGCTCAGGCCCTCATCGTTTCATCAGCGGCGGGGGCGGCGTACTTCATAGTTGCGGACAAGACB) Specify the method for Purification of DNA fragment after digestion.(Genetic engineering).Choose two genes from Figure 4.6 and draw a graph to represent the change in transcription over time.32. The CRISPR-Cas system helps some prokaryotes defend against the phage! Which of the following statements correctly describes how this system works? A) it produces RNA that is translated into proteins that attack viral DNA. B) it inserts specific genes randomly into the prokaryotic genome ) it causes the synthesis of proteins that are then secreted by the prokaryote that attack viruses in the environment. D) it cuts viral DNA at specific sequences before it can replicate.
- 3) Would mRNA vaccines be as effective against bacteria as they are against viruses? Why or why not? Questions related to SARS-CoV-2 Inhibitor Science Article (Zhang et al.) 1) What is the function of the viral main protease? 2) What is the amino acid recognition sequence that is cleave by this main protease? Indicate where this protease cuts? 3) Would interfering with this protease effect other proteases in human cells? 4) How closely related are the amino acid sequences between SARS-CoV-2 and SARS-CoV? What does this suggest about focusing research on inhibiting this enzyme?What are the major components of the CRISPR-Cas9 system? What mechanism does it employ to combine DNA? Explain the process of how the CRISP-Cas9 system is able to create recombinant DNA. Relate the idea of gene modification to the fields of vaccines and applied microbiology as well.Cloning vectors are not just limited to bacterial plasmids. Bacteriophages and M13 phage vectors are also commonly utilized in the cloning process. State any five (5) key criteria to be an effective cloning vector.
- 3 types of common coronavirus tests (RT-PCR for viral RNA with Taqman detection, lateral flow antibody tests, and lateral flow antigen tests) have been examined. a) The RT-PCR with Taqman detection is used to test for viral RNA in univeristy laboratory for testing saliva samples. Why do you think a univerisity chose chose this test to screen students/faculty/staff for Covid-19 on a regular basis? Explain your answer by discussing advantages/disadvantages of the test. b)An antigen test was used to screen students in when they arrived on campus. Why do you think a univeristy chose this test for this purpose? What are advantages and disadvantages of this test? c)Do you think the RT-PCR test with Taqman detection for viral RNA is best test for regular screening? Justify your answer.Briefly and in simple terms, describe how CRISPR could be utilized in treating genetic conditions such as Batten disease.Among the following statements regarding the use of viral vectors, which is (are) true: (can be more then one answer) A.Viral vector transfection has the defect of rapidly killing cells, given the high toxic potential of viruses. B.Generally, the effectiveness of a viral infection transfection is much higher than an electroporation or cationic liposome transfection. C.Even before infecting a cell, a virus can begin to express the indicators, accelerating the process of expression of the indicator in the culture medium. D.Adeno-associated viruses are little used in biophotonics, as they require simultaneous adenovirus infection.