Q: (Y=black/y-yellow). The heterozygotes are the color mixture called calico or tortoise-shell. What…
A: The coat color is encoded by the genes present on the X chromosomes. The black color is present in…
Q: What are the two body dysfunctions of an animal in the order DECaPODA?
A: decapod order Decapoda any of more than 8000 species of crustaceans phylum Arthropoda that include…
Q: In a recent influenza epidemic, physicians were utilizing a rapid diagnostic test to determine which…
A: Influenza It is a viral infection caused by influenza virus. This virus infects the respiratory…
Q: The code for a fully functional protein is actually coming from an mRNA transcript that has…
A: Protein synthesis or translation process involve at least three steps- In the first step there is a…
Q: How do body structures and functions of a flatworm compare with those of a cnidarian for a.…
A: Introduction Platyhelminthes are a group of soft-bodied invertebrates with flattened bodies.…
Q: 9. A 46-year-old woman visited a doctor with complaints of sweating, rapid heartbeat, general…
A: According to the answering guidelines, I'm going to answer only 1st three parts of the given…
Q: Name the method based on a conception, that the diminishing of toxic substances quantity in the…
A: To identify: To identify the correct sorption of toxic substances quantity in the stomach and…
Q: Primary and tertiary structure influence the function of enzyme uniprotkb-p39086
A: enzyme "uniprotkb-p39086" is the uniprot id for the enzyme glutamate receptor. Glutamate ionotropic…
Q: When two trees of different species grow at different rates in the same habitat, the difference in…
A: Plant growth means increased volume or mass of the plant and there are four stages of plant growth…
Q: How hormones affect different classes of vertebrates? Explain each.
A: Hormones are low molecular weight chemical compounds; which are produced in small amounts and act as…
Q: In this chapter, we have reviewed how the puzzle of trees might be addressed by population,markets,…
A: Introduction Pollution may be defined as the contamination with harmful chemicals, and particles…
Q: Galapagos marine iguanas are differentiated by islands. However, the iguanas swim well, suggesting…
A: Answer :: The proportion of alleles (m) of isla tortuga fr isabela. Allele A frequency p=0.2 in next…
Q: Biology is it true that the link caloric effect and cancer is that as calories rise the cancer…
A: Cancer is a broad term that describes a variety of disorders characterised by the uncontrollable…
Q: A membrane protein is made and inserted into the membrane of the rough ER. The protein is then…
A: In eukaryotic cells, the endomembrane system (endo Meaning "inside") is a collection of membranes…
Q: During which of the 3 stages of oogenesis does the oocyte nucleus move?
A: Oogenesis- Oogenesis is the process of formation of female gametes. This process begins inside the…
Q: European cuckoos and North American brown-headed cowbirds are not close relatives, but both lay…
A: Animal behavior is heavily influenced by the environment to which it belongs. If they do not fit in,…
Q: 2. The endosperm of maize can either be yellow of White. with two alleles, Y has yellow endosperm…
A: INTRODUCTION The endosperm is the tissue that surrounds and nourishes the embryo in angiosperm seeds…
Q: What is the difference between anatomy and physiology? How do these two sciences support each other?
A: The human body is a structure made up of many different cell groups that work together to form a…
Q: Briefly describe another technique you can use to study the interaction of Vitamin D3 with lipid…
A: Vitamin D3 with lipid membrane interaction.. Vitamin d3 is very important for our body as it…
Q: The enzyme armylase digests.
A: Amylase is an enzyme made up of protein. It is specific with its substrate and its substrate is…
Q: Zika virus infection, a zoonotic disease, produced somewhat sizable outbreaks recently in certain…
A: To explain: To explain about Zika virus infection and dichotomy
Q: Define the following terms: a. biotechnology:…
A: DNA is a molecule discovered in the nucleus by Friedrich Meischer in the late 1860s, but its…
Q: all
A: The EIDs denotes for the ecology of infectious diseases which is started in 1999 as a joint program…
Q: on tail without carbon-carbon double bonds is saturated with respect to hy ment of proteins in a…
A: Membrane composition and arrangement can be defined by a fluid mosaic model which suggest that…
Q: 10 is missing
A: DNA or deoxyribonucleic acid is the genetic material in living organisms which is made up of…
Q: Further explain cell maintenance
A: The role of telomeres in cell maintainence. Telomeres shows the ends of all eukaryotic chromosomes.…
Q: Concentration of Oxygen in Water Temperature (°C) Oxygen Concentration in Freshwater (ppm) Oxygen…
A: Introduction: Fresh water contains more dissolved oxygen than the seawater and it is…
Q: How many pairs of chromosomes do human beings have, specify the types of chromosomcs also?
A: A chromosome is a lengthy DNA molecule containing some or all of an organism's genetic material.…
Q: Define the term “carbon neutral,” and describe how biomass-based sources have the potential to be…
A: The earth is inhabitable because of the presence of water bodies and oxygen. The atmosphere of earth…
Q: Your vaccine will be administered as a topical cream, and you require your peptide to have an…
A: A topical drug is one that is applied to a specific area of the body or to a specific organ. Topical…
Q: SEQUENCING: Arrange thes systems of animals. Assign nur your notebook. 10. receptor potentia 11.…
A: Reflex arc Pathway along which nerve impulses travels during the reflex action.
Q: Name the method that would be used for each of the following: listening to a patient for a heart…
A: Introduction Heart murmurs are sounds generated by turbulent blood in or near your heart, such as…
Q: For this question please can I have sketch of a map of the pMBBS plasmid showing the relative…
A: Restriction enzymes are also called molecular scissors. These are generally employed in cutting the…
Q: The afflicted individuals in the pedigree have dysphasia-like condition. The gel below shows results…
A: A verbal disorder known as dysphasia or aphasia. It has an impact on how you speak and comprehend…
Q: Explain how meiosis and mutation can cause variation of traits within the population. In your…
A: In sexually reproducing animals such as human beings the advantage is to produce variations. These…
Q: A condition wherein the presence of a certain allele causes death of the organism. O lethal genes O…
A: a condition wherein the presence of a certain allele causes death of the organism is called lethal…
Q: Study the diagram below. Put the number of the step in the diagram by its description in the list of…
A: Restriction DNA technology can be defined as a set of techniques ; in which DNA is identified DNA;…
Q: Describe the difference between a transcriptional fusion and a translational reporter gene fusion.…
A: Transcription fusion means cloning the promoter of interest, upstream of any transcription unit,…
Q: Young tropic birds tend to accumulate fat that they then must lose prior to their first flight. Why
A: Bird flight is the essential method of locomotion involved by most bird species in which birds take…
Q: On May 18, 1980, Mount St. Helens experienced a major eruption that had devastating effects on the…
A: Introduction Ecological succession:- It is the process by which a specific ecology has more or less…
Q: Madison Tavistock, a healthy 2-year-old living in Cincinnati, had attended the Wee Folks Daycare…
A: Introduction :- Vaccination is the process of administering a vaccine to the body in order to…
Q: Heat-sensitive film, which captures the body temperature of organisms on film, is used to photograph…
A: Homeostasis refers to the process of maintaining internal physiological parameters in a changing…
Q: What is seed dormancy? Why is it good?
A: Introduction :- Seed dormancy is an evolutionary trait that inhibits seeds from germinating in…
Q: 1. What are the amino acids translated from the resulting mRNA?
A: The process of transcription occurs only in one strand of the double-stranded DNA. This strand is…
Q: nscript: 3' TACAGTTAAGGCTCCACTGTTA 5' 5' 3' ino Acid Sequence (ex. Met-Trp- and so on) Second letter…
A: The genetic code is the relationship between the sequence of bases in DNA and the sequence of amino…
Q: What is the difference between endergonic andexergonic chemical reactions?
A: A chemical reaction is the transformation of one or more reactants into one or more products.…
Q: What is the name of the process by which bacteria pick up a different organism’s genetic material?
A: 4. A bacterium takes up a fragment of DNA circulating in its surroundings during transformation. A…
Q: What is seed dormancy? Why is it good?
A: Introduction A seed is an embryonic plant with a protective coating around it. Seed development is a…
Q: QUESTION 1 Loci Recombination Frequency (%) L and M 50 L and N 19 L and O L and P 50 50 M and N 50 M…
A: The test cross is done to find the genetic map. The crossing of unknown parent is done wit…
Q: Biology Find examples of: One population outbreak and its cause. One population cycle and its cause.
A: Population is a collection of individuals of the same species that live together in a region.…
answer in 15 minutes
giving examples to illustrate your answer define both selective media and enrichment media as might be used in clinical
Step by step
Solved in 2 steps
- Data Both plates were inoculated with the same 4 bacteria and in the same pattern, but were incubated in either the CampyPak or GasPak systems. Compare the growth on either plate and log the data in the table in the next slide. Answer the questions on the next slide. GasPak Plus Pouch for growth under anaerobic conditions CampyPak Pouch for growth under microaerophilic conditions (similar to candle jar technique) S. PYOGENES S. PYOGENES M. LUTEUS M. LUTEUS C. SPOROGENES E. COLI C. SPOROGENESgiving examples to illustrate your answer define both selective media and enrichment media as might be used in clinical microbiologyBuild four flash cards, one for Chocolate, MacConkey, TSA-blood and CNA-blood agar media. Your Mac card must be different than the one in the presentation. Post your FOUR flash cards on the discussion board. They MUST include: • A picture of the medium IN COLOR. • All the relevant info about the medium
- MICROBIOLOGY: Microscopic Morphology of Microbes Write your introduction (This includes principles, significance of the study, objectives of the experiment and how the objectives were achieved. This part must also be in the passive voice and past tense. Introduction must be short but packed with relevant content). another: What is the advantage of the Gram stain over the simple stain? What is the theory about the mechanism of the Gram-stain reaction?Question 14 If a suspect bacterial pathogen infecting your patient is known to be "fastidious" which medium would you grow this pathogen on? selective media such as MacConkey agar enrichment medium such as blood agar differential medium such as MSA O all purpose medium such as SAB Question 15Need help A medium that inhibits the growth of Gram positive bacteria allowing Gram negative ones to grow and in turn contains an indicator such as crystal violet denoting a color change of the colonies to red, it is a medium .which medium and explain why ? selective / enriched selective / differential differential
- what are the 7 indicator microorganisms that must not be exist in pharmaceutical products ? how we can idenfy them in products Please answer asap and type your answer and do not copy from anywhere please answer asapHow would you draw out a step in an experiment that included the following? Please help, I am so lost. Metal coupon inoculation (vortex/bead method) and assessment of viable cells by culture to simulate wet fomite or dry touch surface contamination.A differential media is designed to inhibit the growth of some organisms while encouraging the growth of others. O True False
- Question:- Describe control strains used in the clinical microbiology laboratory and explain their maintenance in the laboratory. ( write BY WORD and all steps I need). Introduction Discussion ReferencesHave bacteria been successfully isolated on the Petri dish in this picture? ASM MicrobeLibrary.org © Katz Yes O NoExperiment #1 From Antoinette de Senna’s Master’s thesis on ‘Screening of biological control organisms for the management of phytopathogenic fungi and foodborne pathogens on produce’. Objective: To screen three LAB (Lactobacillus plantarum, Pediococcus acidilactici, and Pediococcus pentosaceus) for antimicrobial activity against the foodborne pathogens Listeria monocytogenes, Salmonella, and Escherichia coli. Methods: 1 ml of the pathogen was placed into a petri dish. Then, 15-20 ml molten tryptic soy agar (TSA) tempered to 50°C was added. When the TSA solidified, a loopful of LAB was spotted onto the agar. Plates were incubated at 35°C for 24 hours then the zone of inhibition was measured from the boarder of the bacterial colony to the perimeter of the clearing. Results: Questions: What is the independent variable? What is the dependent variable? Suggest a control for this experiment? What is the optimal temperature range for Listeria monocyogenes? Is monocyogenes a…