I am reading in two integers from a file. For example my input.txt file has the integers : “4–5” I am able to open the file and store the first value (4) into variable n but I can't store the second integer value (5) into variable m, I think the computer reads the dash as the next integer instead of the actual integer which is 5, how can I create a code that ignores the dash when searching for the integer in the input.txt? Thank you

I am reading in two integers from a file. For example my input.txt file has the integers : “4–5” I am able to open the file and store the first value (4) into variable n but I can't store the second integer value (5) into variable m, I think the computer reads the dash as the next integer instead of the actual integer which is 5, how can I create a code that ignores the dash when searching for the integer in the input.txt? Thank you

Name: Good day/evening , C++ help needed.I am reading in two integers from a
Uploaded: 2024-03-20T06:51:23.000Z
Channel: Bartleby
Description: Good day/evening , C++ help needed.I am reading in two integers from a file. For example my input.txt file has the integers : “4–5”I am able to open the file and store the first value (4) into variable n but I can't store the second integer value (5)

EBK JAVA PROGRAMMING

9th Edition

ISBN:9781337671385

Author:FARRELL

Publisher:FARRELL

Chapter13: File Input And Output

Section: Chapter Questions

Problem 6PE

See similar textbooks

Similar questions

Python Coding-(On Pycharm Community Edition) Create a mini-lottery with TEXT ticket. The user is going to save three numbers in a text file - those three numbers are from 1-9. In Python, create a program that reads those three numbers from the text file (ticket) Use a random number generator to draw three random numbers Compare the text ticket and the random numbers. If they match number (see below), output the prize The numbers can be in any order the random numbers can be duplicates, so be careful how you count! This work in a similar way to mini-assignment number 48 - but you DO NOT have to write to a text file. Have the user enter the numbers into the text file. Append the numbers read from the text file to a list read each number from the list and compare it to the randomly generated numbers you come up with One number match - free ticket Two numbers match - $2.00 Three numbers match - $10.00 -you don't have to complete bonus, it would be great if you could-…
python:def ohno_twozero(placeholder, statement): """ Question 1 - Regex You are typing a personal statement but accidentally used the number 0 instead of the letter o (the two are very close on the keyboard). After realizing this, seeing the mistake once does not bother you, but you absolutely cannot tolerate seeing it twice in a row. Therefore, you will need to replace any WORD where '00' shows up at any point with the given placeholder. Do not replace any NUMBER where 00 shows up. (e.g. '100' should stay as '100' and not be replaced with the placeholder). You may assume that when '00' shows up in a word, there will be at least one letter preceding it. Return the output string after making these changes. THIS MUST BE DONE IN ONE LINE. Args: placeholder (str) statement (str) Returns: str >>> ohno_twozero('epic', "I am n0w l00king at 500 t0tal h0urs 0n Super Smash Br0s.") "I am n0w epic at 500 t0tal h0urs 0n Super Smash…
Use C++ In a student file, there are names and scores. Find the max score and print out the names of the students with the max score. • You must get a filename as standard input. See two sample outputs on the next page. • The number of students in the file is at most 50. • You need to make two arrays (see the next page). 1. Create a string array with size 50. The array will store the names of the students. 2. Create an integer array with a size of 50. The array will store the scores of the students.
Python programming-basics homework assignment: Write a program that inputs a text file, should print unique words in file in abc order, uppercase words should take precedence over lower. this is example of output: example text file: brown dog fox jumps lazy over quick the example output: brown dog fox jumps lazy over quick the THis is MY output: thequickbrownfoxjumpsoverthelazydog This is my code: QUESTION: why it won't SORT or removing unique text like example output: # Put your code herefileName = input("Enter the input file name:")word_list = []with open(fileName) as words: for line in words: line.rstrip() for list_of_words in line.split(): print(list_of_words) word_list.sort() for list2_words in word_list: if list2_words not in word_list: word_list.sort() word_list.append(list_of_words) for new_words in line.split(): print(new_words)
You will have an orthogonal triangle input from a file and you need to find the maximum sum of the numbers according to given rules below; 1. You will start from the top and move downwards to an adjacent number as in below. 2. You are only allowed to walk downwards and diagonally. 3. You can only walk over NON PRIME NUMBERS. 4. You have to reach at the end of the pyramid as much as possible. 5. You have to treat the input as pyramid. 215 193 124 117 237 442 218 935 347 235 320 804 522 417 345 229 601 723 835 133 124 248 202 277 433 207 263 257 359 464 504 528 516 716 871 182 461 441 426 656 863 560 380 171 923 381 348 573 533 447 632 387 176 975 449 223 711 445 645 245 543 931 532 937 541 444 330 131 333 928 377 733 017 778 839 168 197 197 131 171 522 137 217 224 291 413 528 520 227 229 928 223 626 034 683 839 053 627 310 713 999 629 817 410 121 924 622 911 233 325 139 721 218 253 223 107 233 230 124 233
You will have an orthogonal triangle input from a file and you need to find the maximum sum of the numbers according to given rules below; 1. You will start from the top and move downwards to an adjacent number as in below. 2. You are only allowed to walk downwards and diagonally. 3. You can only walk over NON PRIME NUMBERS. 4. You have to reach at the end of the pyramid as much as possible. 5. You have to treat your input as pyramid. According to above rules the maximum sum of the numbers from top to bottom in below example is 24. *1 *8 4 2 *6 9 8 5 *9 3 As you can see this has several paths that fits the rule of NOT PRIME NUMBERS; 1>8>6>9, 1>4>6>9, 1>4>9>9 1 + 8 + 6 + 9 = 24. As you see 1, 8, 6, 9 are all NOT PRIME NUMBERS and walking over these yields the maximum sum. Write code for below problem in C language
You will have an orthogonal triangle input from a file and you need to find the maximum sum of the numbers according to given rules below; 1. You will start from the top and move downwards to an adjacent number as in below. 2. You are only allowed to walk downwards and diagonally. 3. You can only walk over NON PRIME NUMBERS. 4. You have to reach at the end of the pyramid as much as possible. 5. You have to treat your input as pyramid. According to above rules the maximum sum of the numbers from top to bottom in below example is 24. *1 *8 4 2 *6 9 8 5 *9 3 As you can see this has several paths that fits the rule of NOT PRIME NUMBERS; 1>8>6>9, 1>4>6>9, 1>4>9>9 1 + 8 + 6 + 9 = 24. As you see 1, 8, 6, 9 are all NOT PRIME NUMBERS and walking over these yields the maximum sum. According to RULES that you implemented what is the maximum sum of below input? It means please take this input (as file or constants directly inside the code) for your implementation and…
You will have an orthogonal triangle input from a file and you need to find the maximum sum of the numbers according to given rules below; 1. You will start from the top and move downwards to an adjacent number as in below. 2. You are only allowed to walk downwards and diagonally. 3. You can only walk over NON PRIME NUMBERS. 4. You have to reach at the end of the pyramid as much as possible. 5. You have to treat the input as pyramid. 215 193 124 117 237 442 218 935 347 235 320 804 522 417 345 229 601 723 835 133 124 248 202 277 433 207 263 257 359 464 504 528 516 716 871 182 461 441 426 656 863 560 380 171 923 381 348 573 533 447 632 387 176 975 449 223 711 445 645 245 543 931 532 937 541 444 330 131 333 928 377 733 017 778 839 168 197 197 131 171 522 137 217 224 291 413 528 520 227 229 928 223 626 034 683 839 053 627 310 713 999 629 817 410 121 924 622 911 233 325 139 721 218 253 223 107 233 230 124 233 Need the answer in python
You will have an orthogonal triangle input from a file and you need to find the maximum sum of the numbers according to given rules below; 1. You will start from the top and move downwards to an adjacent number as in below. 2. You are only allowed to walk downwards and diagonally. 3. You can only walk over NON PRIME NUMBERS. 4. You have to reach at the end of the pyramid as much as possible. 5. You have to treat your input as pyramid. According to above rules the maximum sum of the numbers from top to bottom in below example is 24. *1 *8 4 2 *6 9 8 5 *9 3 As you can see this has several paths that fits the rule of NOT PRIME NUMBERS; 1>8>6>9, 1>4>6>9, 1>4>9>9 1 + 8 + 6 + 9 = 24. As you see 1, 8, 6, 9 are all NOT PRIME NUMBERS and walking over these yields the maximum sum. According to rules what is the maximum sum of below input? It means please take this input (as file or constants directly inside the code) for your implementation and solve by using it.…
The file “dna.seq” (on Blackboard) consists of several DNA sequences. Write a program that reads in the file “dna.seq” and counts the number of sequences with the following properties:• The total number of sequences in the file• The number of sequences that have the pattern CTATA• The number of sequences that have more than 1000 bases• The number of sequences that have over 50% GC composition• The number of sequences that have more than 2000 bases and more than 50% GCcompositionUse python
The file "dna.seq" (on Blackboard) consists of several DNA sequences. Write a program that reads in the file "dna.seq” and counts the number of sequences with the following properties: • The total number of sequences in the file • The number of sequences that have the pattern CTATA • The number of sequences that have more than 1000 bases • The number of sequences that have over 50% GC composition • The number of sequences that have more than 2000 bases and more than 50% GC composition Some program requirements: (1) the program should prompt the user for the filename. (2) each of the above tasks should be its own function. dna seg file = CAAAGATTAAGCCATGCATGTCTAAGTATAAGCAATTATACCGCGAAACTGCGAATGGOTCATTAAATCACT TATCGTTTATTTGATAGTACCTTACTACATGGATAACCGTGGTAATTCTAGAGOTAATACATGOTAAAAAGO CCGACTCACGGAGGGTTGTATTTATTAGATTAAAAA
You will have an orthogonal triangle input from a file and you need to find the maximum sum of the numbers according to given rules below; 1. You will start from the top and move downwards to an adjacent number as in below. 2. You are only allowed to walk downwards and diagonally. 3. You can only walk over NON PRIME NUMBERS. 4. You have to reach at the end of the pyramid as much as possible. 5. You have to treat your input as pyramid. According to above rules the maximum sum of the numbers from top to bottom in below example is 24. *1 *8 4 2 *6 9 8 5 *9 3 As you can see this has several paths that fits the rule of NOT PRIME NUMBERS; 1>8>6>9, 1>4>6>9, 1>4>9>9 1 + 8 + 6 + 9 = 24. As you see 1, 8, 6, 9 are all NOT PRIME NUMBERS and walking over these yields the maximum sum. According to rules that you implemented what is the maximum sum of below input? It means please take this input (as file or constants directly inside the code) for your implementation and…