Identify the major and minor grooves in the DNA molecule PDB ID 141D. In addition, one end of a strand is shown magnified and rotated. Identify whether it is the 5' end or the 3′ end, and identify the base. Answer Bank major groove 3' guanine 3' thymine 5' cytosine minor groove 5' adenine
Q: A major challenge to cells that are metabolizing amino acids is: A) changes in pH due to acidic and…
A: Amino acids are biomolecules that have an amino group a carboxyl group and a side group attached to…
Q: How does insulin cause an increase in the rate of glucose transport into cells when blood glucose…
A: Insulin is a peptide hormone that helps to maintain the glucose levels in the blood. When there is…
Q: Consider the image of protein synthesis (translation). Identify the two different RNA molecules…
A: Translation refers to the process of protein synthesis. It falls under the process of gene…
Q: Why could the acrolein test be used as a general test for all fats?
A: The qualitative analysis of lipids assists us in determining the presence or absence of lipids based…
Q: One of the functions of the pentose phosphate pathway is to make NADPH, which plays important roles…
A: Nicotinamide adenine dinucleotide phosphate (NADP+) is used as a cofactor in anabolic reactions.…
Q: Coenzyme A is: A) a form of cellular energy. OB) an anabolic electron carrier. C) a catabolic…
A: Cells convert energy into small, energy-rich molecules such as ATP and nicotinamide adenine…
Q: What is the function of uncoupling proteins in hibernating mammals? ○ A) They allow protons…
A: Uncoupling protein 1 or UCP1 (thermogenin) and is important in helping animals keep warm during the…
Q: does BPG bind to deoxyhemoglobin only?why BPG does not bind to oxyhemoglobin? what is chemical…
A: Hemoglobin is a globular protein, ie it is roughly spherical. It is a tetramer of two types of…
Q: Match the following steps of oxidative phosphorylation in increasing order from beginning (1) to end…
A: Aerobic catabolism of 1 molecule of glucose can produce 10 NADH (6 from acetyl CoA in the TCA cycle…
Q: The genetic code is said to be degenerate. This means that each codon codes for more than one amino…
A: INTRODUCTION: Genetic code - The genetic code is defined as the set of rules or instructions which…
Q: Question 3 Matching. Some answer(s) could be matched more than once to a question. ✓ Patients'…
A: After a meal, there is a surplus supply of glucose in the blood. this causes the pancreas to secrete…
Q: Questions 11-13- refer to the carbohydrate mannose (open chain and one anomeric ring configuration…
A: Carbohydrates are polyhydroxy aldehydes or ketones. They can be classified as monosaccharides,…
Q: Choose the correct path taken by a pair of electrons as they travel down the electron-transport…
A: Electron transport chain consists of a group of protein complexes in the mitochondrial membrane…
Q: 3 why do heat and acid denature proteins 4 what are enzymes and how they work? discuss one example…
A: Proteins are folded peptides. Peptides are polymers of amino acid residues linked via peptide bonds.…
Q: Why is the name the "citrate cycle" a more accurate name for the metabolic pathway discovered by…
A: Critic acid cycle also called as tricarboxylic acid cycle is the second stage in aerobic cellular…
Q: The Cori cycle involves the: OA) conversion of glucose to lactate in liver and lactate to glucose in…
A: The Cori cycle is also known as the lactic acid cycle. During muscular activity, when oxygen supply…
Q: Identify the hormones that have great contribution to metabolism, determine their function, action…
A: Metabolism is the total of all chemical transformation that takes place in a living cell. One…
Q: Capping of eukaryotic mRNA occurs at the 5' end O occurs at the 3' end O occurs at both ends O…
A: Transcription is the process by which the genetic information stored in the DNA is copied onto a…
Q: The location of enzymes is important for metabolic pathways. Which of the following enzymes is NOT…
A: Metabolic pathways require enzymes to catalyse their reactions. The pathways that occur in a…
Q: 1 Describe the difference between amylose and amylopectin. 2 what is the monosaccharide that…
A: Chemically, carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula :…
Q: Which of the following statements is TRUE concerning the synthesis of the leading and lagging…
A: DNA replication is a process by which one molecule of DNA is duplicated to 2 molecules of DNA. The…
Q: The drug below is used in the treatment of: O Rheumatoid arthritis. O Gram(+) bacterial infections.…
A: Heterocyclic ring is a ring structure made up of different atoms. Given to us a heterocyclic…
Q: Over the course of glycolysis and the citric acid cycle, there are 10 NADH and 2 FADH₂ produced per…
A: Number of ATP formed from each molecule of NADH and FADH2 through oxidative phosphorylation helps in…
Q: Which of the following can serve as a source of carbon for gluconeogenesis? O cholesterol O alanine…
A: Gluconeogenesis is the metabolic pathway that produces glucose from non carbohydrate precursors.…
Q: A drug with an elimination half-life of 1 hour was given to a male patient weighing 60 g by IV at…
A: Given, Rate of administration IV (R) is 300 mg/hr Plasma drug concentration at 7 hours was (C) 11…
Q: Fatty acids released by hormone sensitive lipase in adipocytes are transported to muscle by: OA)…
A: The adipose tissue stores surplus nutrients in the form of neutral lipids in the body that in turn…
Q: D-Talose is a C2 epimer of D-galactose. Using the Fischer projection structure, draw the product of…
A: The structure of D-Talose is given below.
Q: What is the correct order, from highest content to lowest content, for triacylglycerols in the…
A: Lipoproteins are droplets of fats that are surrounded by a single layer of phospholipid molecules.…
Q: Which of the following is a substrate from primase?
A: DNA/RNA are nucleic acids, the molecules responsible for carrying genetic information from one…
Q: IV. Write on the first column the monosaccharide unit(s) that is present in the given disaccharide.…
A: Carbohydrates are polyhydroxy aldehyde or ketone or produce similar units on hydrolysis. The basic…
Q: Which is true about signaling receptors? They are transmembrane proteins that have binding…
A: Signalling receptors are the transmembrane proteins that span the plasma membrane of the cell. they…
Q: The final electron acceptor of the mitochondrial electron transport system is FAD NADH NAD+…
A: Cellular respiration is the process how biochemical energy is generated from food. It involves the…
Q: Question 9 I am an alanine residue present in a peptide with defined secondary structure. I have and…
A: Introduction Proteins are the most abundant macromolecule of our body. Amino acids are the building…
Q: Which of the following is NOT a zymogen? A) Chymotrypsinogen. B) Proelastase. C) Enteropeptidase.…
A: Zymogens are inactive form of enzymes that upon successful cleavage and processing are converted to…
Q: Metabolism processes that generate fadh2 are select all that apply beta oxidation…
A: FAD is a derivative of the vitamin B2 or Riboflavin. It acts as coenzyme in most of the oxidation…
Q: As a result of complete fasting for 3 days, a significant change in metabolism occurs. How will the…
A: Cells are machinery structures which carry out various complex controlled biochemical reactions in…
Q: What is the dissociation equilibrium constant of a protein if the concentration of free ligand is…
A: Consider the following reaction: P + L ⇌k2k1 PL where P is the protein, L is the ligand and k1 and…
Q: In its non-phosphorylated state, glycogen phosphorylase can be activated by which of the following…
A: Glycogen phosphorylase is the regulatory enzyme of the glycogenolysis pathway. Glycogenolysis is the…
Q: 18. A biochemist has a 0.1000 L sample of a globin protein at a concentration of 0.0500 M. The P50…
A: Recall that: Fractional Saturation (θ) is the fraction of protein molecules saturated with a ligand.…
Q: E. coli replication on the lagging strand O is carried out by DNA polymerase I O is initially…
A: In E. coli genetic information is stored in form of DNA. E. coli DNA is circular in shape. DNA…
Q: Complete the following reaction: P680 + light →_______→ O P680*; P680 + H+ O P680*; P680* + e O…
A: The P680 reaction center is a part of photosystem II. Upon getting hit by photons, P680 gets…
Q: Which of the following coenzymes does not get restored to it's original form within the PDH complex…
A: PDH (pyruvate dehydrogenase complex) is an enzyme complex, which is composed of three enzymes known…
Q: What are the health benefits of squash in a dessert recipe?
A: Squash is a comforting, delicious, and nutritious meal that is a mainstay throughout the autumn…
Q: How many ATPs are generated in the reaction: Glucose to oxidation to 2 acetyl CoA via Glycerol…
A: A redox reaction is where oxidation and reduction occur simultaneously. In glycolysis, there is a…
Q: Question 1: What is the cost (in number of ATP equivalents) of the synthesis of by the salvage…
A: oleate is mono-unsaturated FA with 18C and palmitate is saturated fatty acyl chains with 16 carbon…
Q: FRET is a widely used biophysical technique for the characterization of a wide range of biomolecular…
A: FRET is a unique method for measuring the separation between a donor-acceptor pair of chromophores.…
Q: Which of the following is true about myoglobin and/or hemoglobin?nd a. The iron in hemoglobin is in…
A: Since you have posted multiple MCQ questions, we will provide the solution only to the first three…
Q: Which of the following statements concerning insulin is NOT true? a. Insulin can increase glycogen…
A: Glycolysis is the metabolic process that breaks down glucose into pyruvate. Gluconeogenesis if the…
Q: In order to activate glucose for storage as glycogen, what must be added to each glucose? A)…
A: Glycogen is a branched glucose polymer that is used as an energy reserve in animal cells. The…
Q: Discuss the cellular location and biological significance of the processes of the citric acid cycle…
A: Cellular respiration is a collection of three metabolic pathways that generate ATP by the oxidation…
asap
Trending now
This is a popular solution!
Step by step
Solved in 3 steps with 2 images
- Identify the major and minor grooves in the DNA molecule PDB ID 141D. In addition, one end of a strand is shown magnified and rotated. Identify whether it is the 5' end or the 3′ end, and identify the base. Answer Bank 5' cytosine 3' guanine 3' thymine major groove minor groove 5' adenineGiven the DNA template strand 3' GCATTCAAG 5', write the amino acid sequence in the N‑terminal to C‑terminal direction. Note: Enter the amino acids using their three-letter designations. Put a hyphen between each amino acid.Write the base sequence and label the 3' and 5' ends of the complementary strand for a segment of DNA with the following base sequences: 5'CGGAC3'
- If I tell you that a stretch of DNA in the 5' to 3' direction is AGGTACGACCGT Give me the complimentary strand without and spaces, commas, symbols or anything else besides the nucleotide sequence (e.g. only: AAGCATCCGCTTA). Give me the complimentary sequence in the 3' to 5' orientation.Below is an image of a basepair and associated ribose rings as viewed down the helical axis in B DNA (black spheres are oxygen atoms; red lines are hydrogen bonds). G1 B1 G2 G4 Identify the base marked as B1. Identify the base marked as B2. B2 adenine thymine G3 Identify the general location (G1-G4) of the minor groove. G4 Identify the general location (G1-G4) of the major groove. G2 >Given this sequence (of course the DNA is double stranded, but I’m only showing one strand), will it tend to cause a deletion to form, or an inversion? Diagram how it (either the deletion or inversion) will happen. xxxxxxxcatatgctttcag (another five hundred or so letters) catatgctttcagxxxxxxxxx Ditto, using this sequence xxxxxxxxcatatgctttcag (another five hundred or so letters) gactttcgtatacxxxxxxxxxxx
- What is the nucleotide sequence of the complementary strand of the DNA molecule: 5’-AATGCGATCTTCAT-3’? Indicate the 5’ and 3’ ends. Follow the same format as the given sequence.Write the complementary strand to the following single-stranded DNA and label the 5' and 3' ends: 5'-ATAGCATGGGCCATACGATTACTGA-3'Give the sequence of the complementary DNA strand for the DNA chain with the following base sequence5'-TATGGCATAC-3'
- What is the conformation of the glycosidic bond (i.e. orientation of the nucleobase relative to the the sugar) in the B-form of DNA? syn anti alpha heteroHere is a DNA coding strand’s sequence and direction: 5’-ATGCCGATATAG-3’ . What would be the amino acid sequence in the polypeptide encoded by this DNA?Examine the following DNA sequence (only one strand is shown). The shown strand will be referred to as Strand 1. The complementary strand will be referred to as Strand 2: 5’ TTTAAGCCGTACCGATATAATGTAAGGCGAGCTTGACCGTCTTGGGCATCATA 3’ There is an eleven (11) base pair sequence that serves as a replication origin. Write below the most likely 11 nucleotides on this strand that serve as the replication origin. Think carefully about base pairing.