In bacteria, what is the role of the Shine-Dalgarno sequence? Question 3 options: It binds to the initiator tRNA It stabilizes the mRNA structure during elongation It is recognized by a UC-rich motif found on 16S rRNA It interacts with release factors to terminate translation

In bacteria, what is the role of the Shine-Dalgarno sequence? Question 3 options: It binds to the initiator tRNA It stabilizes the mRNA structure during elongation It is recognized by a UC-rich motif found on 16S rRNA It interacts with release factors to terminate translation

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter13: Gene Expression

Section13.4: Translation

Problem 3C: A certain mRNA strand has the following nucleotide sequence: 5AUGACGUAUAACUUU3 What is the anticodon...

See similar textbooks

Related questions

Q: List three important characteristics of plasmids and their function

A: Here is the Three important characteristics of plasmid and their functions.Autonomous…

Q: Parts of the mechanism for lysozyme are shown below. The catalytic lysozyme residue side chains can…

A: Lysozymes cleave the glycosidic bond between N-acetylmuramic acid (Mur2Ac) and N-acetylglucosamine…

Q: How does a protein 'know' how to fold into its native conformation and in general why is folding…

A: Proteins are made up of amino acids, which are linked together in a specific sequence by peptide…

Q: Question 1: Part a: Graph Y = [I] / (Ki + [I]) as a function of [I] and Ki = 2 µM; and describe the…

A: Part a:The equation Y = [I] / (Ki + [I]) represents a fractional saturation curve, often used in…

Q: 13. The structures of sphingosine and choline are given below. Draw the condensed structure and…

A: Sphingolipids has sphingosine as its platform molecule. Onto this sphingosine, a head group and a…

Q: Week 8 Q1

A: The objective of this question is to understand the concept of translocation in genetics and to…

Q: You are working on a protein with the following sequence in an area of interest.…

A: Proteins are made up of different amino acids. Some amino acids have ionizable side chains. All…

Q: The cofactor shown below: is an oxidizing agent is a reducing agent is a carrier of acyl groups is…

A: The given structure is of the FAD molecule. FAD = Flavin adenine dinucleotide.

Q: Question 2: Part a: Complete the table describing different components of intron removal from mRNA.…

A: Part b: Group I Self-Splicing Intron Removal from 26S rRNA in TetrahymenaGroup I introns are a class…

Q: (e) What kind of inhibitor is it likely to be? Plot the data in Lineweaver-Burk plot form to support…

A: For a one-substrate enzyme-catalyzed reaction, the Michaelis-Menton equation shows the quantitative…

Q: Blood plasma contains a total carbonate pool (essentially HCO3 and CO₂(d)) of 2.5 x 10-2 M. What…

A: In order to solve this problem, first we need to calculate the initial concentrations of bicarbonate…

Q: List 4 major types of inhibition modes and clearly indicate the effect on Vmax and KM for each mode?

A: “Since you have posted multiple questions, we will provide the solution only to the first question…

Q: 1. Substrate Enzyme 1 2 3 Look at the above diagram and understand what is being shown. Explain AND…

A: Enzymes are proteins that catalyze biochemical reactions. The substrate binds to the enzyme's active…

Q: I need help with drawing Hydrogen bonding between two tripeptide: Ser-Lys - Ser. In my class, we are…

A: The peptide backbone has a zig-zag structure with the hydrogen and side chain bonded to alpha-carbon…

Q: Many pharmaceuticals exert their action by inhibiting the activity of enzymes. Choose the false…

A: Enzyme inhibition occurs when certain substances, called inhibitors bind to and inactivate enzymes.…

Q: Draw a parallel beta sheet and an antiparallel beta sheet (three strands each). Show the hydrogen…

A: The secondary structure of protein refers to the local folded structure that forms within in…

Q: Draw the structures of Allura Red and the reduced products formed when it had reacted with NADH

A: Allura red is synthetic food coloring, it is a red azo dye that is frequently used in various food…

Q: how does the protein porin cross the lipid bilayer in a cell membrane

A: The objective of this question is to understand the mechanism by which the protein porin crosses the…

Q: Question 7

A: The objective of this question is to determine how many of the bacterial cells will be radioactive…

Q: A bacterial cell divides in the presence 32p, which is a radioactive isotope of phosphorous. This…

A: In conservative DNA replication both the strands of DNA of the parent cell become part of one of the…

Q: A coal fire plant uses 1 kg of coal to generate 1000 kWh of electricity and emits 50 kg of CO2 and 5…

A: The objective of the question is to understand the relationship between the functional unit (FU) and…

Q: Draw and label a diagram showing four DNA nucleotides, linked together in two strands. PLEASE DRAW…

A: Nucleic acids are biomolecules responsible for the storage and transmission of genetic information…

Q: In a tabular form list two differences between heat shock and electroporation as methods of…

A: Transformation is the process by which a cell takes in naked DNA from its environment. Heak shock…

Q: 13. Amino acid analysis of a seven residue long peptide gave Asp Leu Arg Met | Phe Met | Phe | Tyr…

A: ANSWER:Tyr - Asp - Phe - Met - Leu - Arg - X The amino acid sequence of the seven-residue long…

Q: Plot based on chart

A: Standard curve or plot is the graph that is absorbce vs known concentration of proteins. This graph…

Q: Consider a crude extract with a mixture of the 5 proteins listed below. Protein A 4.5 pl 160…

A: Ion Exchange ChromatographyIon exchange chromatography can be used to separate proteins that have a…

Q: What is the difference in ATP yield per glucose molecule between the malate-aspartate shuttle and…

A: During glycolysis of glucose, 1 molecule of glucose yields 2 molecules of NADH. The high energy…

Q: Biochemistry...Represent the reactions when Phosphatidylethanolamine was treated with; (I)…

A: Phosphatidylethanolamine (PE) is a type of phospholipid found in cell membranes. It consists of a…

Q: Can you help with q3 please, thank you.

A: The intermolecular interactions for the given active site of RNA is listed below . Explanation:Step…

Q: Describe how chymotrypsin is activated via a cascade mechanism in the gut. How does it incorporate a…

A: Chymotrypsin is one of the enzyme present in the digestive juices and it helps in the breakdown of…

Q: Transcription factors bind to: Question 20 options: DNA regions called…

A: Transcription factors bind to: DNA regions called cis-acting elementsExplanation:The question…

Q: Question 6

A: The question is asking whether a mouse would die if it was injected with heat-treated S strains.…

Q: The protein on the right called desmolaris, also called Draculin, found in bats. It is a non…

A: An injury to blood vessels leads to the leakage of blood and this is stopped via a process called…

Q: To which class of lipid does the molecule below belong? OH HO OH H ...CH 3 H O eicosanoid O…

A: The objective of the question is to determine which category does the given molecule belongs.

Q: Sickling occurs in deoxyhemoglobin S but not in oxyhemoglobin S. Oxyhemoglobin has a small,…

A: Sickling is the process where the haemoglobin protein inside the RBC cell clumps together this…

Q: Reverse translate the sequence of insulin pasted…

A: To reverse translate the given sequence of insulin and optimize the codons for Homo sapiens and…

Q: A glucose molecule with its 3rd carbon radiolabelled underwent glycolysis. Which carbon atom in the…

A: During the process of glycolysis, glucose is broken down into pyruvate and energy, producing two…

Q: Cysteine proteases are remarkably similar to serine proteases (like chymotrypsin), except they have…

A: Cysteine proteases are a class of enzymes that degrade proteins by using a nucleophilic cysteine…

Q: G Which of the following amino acids is most unlikely to be present in a beta sheet? Lysine Valine…

A: Proteins show two types of secondary structural elements. They are1) Alpha helix and2) Beta sheets .…

Q: How is plasmid DNA distinguished from coli chromosomal DNA using the Qiagen Miniprep protocol?

A: In the Qiagen Miniprep protocol, plasmid DNA is distinguished from E. coli chromosomal DNA based on…

Q: Corona virus tes with a 5% false positive rate and a Corona virus infection rate of 5% in Canada, if…

A: The objective of the question is to calculate the probability that a person who tests positive for…

Q: Extension Questions Which of the following sequences correctly represents the flow of electrons…

A: Extension questions •The correct sequence representing the flow of electrons during photosynthesis…

Q: 5'-AATGCCTCAGCCGATCTGCCTCGAGTCAATCGA TGCTGGTAACTTGGGGTATAAAGCTTACCCATGGTATCGTAG…

A: PCR is a lab technique used for amplification of target DNA sequence by using a thermostable DNA…

Q: Genetics Question 11

A: The objective of the question is to identify the stage of meiosis and the parent in which…

Q: Question 12 In the tertiary structure of a protein, the R-group of valine can interact with the…

A: Proteins are bio molecules with vast diversity in their structure. They exhibit four levels of…

Q: In the following scheme: HNH, IT H,C-C-C-Coo II H HO 1 O NH, 1 H₂C-C-C-COOⓇ H 2-Amino-3-ketobutyrate…

A: Metabolism consists of catabolism and anabolism. Catabolism refers to the breakdown of compound to…

Q: 4. a. For an exponentially growing population, calculate umax (units?) based on the data below Time…

A: Monod kinetics describe the relationship between the growth rate of microorganisms and the…

Q: . If 20 mM solution of Acetyl-phosphate is transformed to acetate by incubating with a catalytic…

A: Initially there was 20 mM acetyl-phosphate. At equilibrium, the acetyl-phosphate concentration…

Q: You have a protein with MW 48kDa. How many grams of protein are in a 200 mL sample at 50 μM?

A: To calculate the amount of protein in grams in a 200 mL sample with a concentration of 50 μM, follow…

Q: Which model (2D topology or trRosetta) is likely a better representation of the actual protein AlaE,…

A: In the context of protein structure prediction, the posterior probability is generally considered a…

Concept explainers

Genetic Recombination

Recombination is crucial to this process because it allows genes to be reassorted into diverse combinations. Genetic recombination is the process of combining genetic components from two different origins into a single unit. In prokaryotes, genetic recombination takes place by the unilateral transfer of deoxyribonucleic acid. It includes transduction, transformation, and conjugation. The genetic exchange occurring between homologous deoxyribonucleic acid sequences (DNA) from two different sources is termed general recombination. For this to happen, an identical sequence of the two recombining molecules is required. The process of genetic exchange which occurs in eukaryotes during sexual reproduction such as meiosis is an example of this type of genetic recombination.

Microbial Genetics

Genes are the functional units of heredity. They transfer characteristic information from parents to the offspring.

Question

In bacteria, what is the role of the Shine-Dalgarno sequence?

Question 3 options:

	It binds to the initiator tRNA
	It stabilizes the mRNA structure during elongation
	It is recognized by a UC-rich motif found on 16S rRNA
	It interacts with release factors to terminate translation

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1: What is the Shine-Dalgarno sequence

VIEW

Step 2: Explanation of the different options

VIEW

Solution

VIEW

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.

Similar questions

Briefly describe the function of the following in protein synthesis. a. rRNA b. tRNA c. mRNA
A point mutation within the DNA sequence of a gene, which turns the codon UGU (codes for the amino acid cysteine) into the codon UGA would Question 47 options: build in another amino acid into the growing polypeptide chain at the ribosome build in the same amino acid (= cysteine) at the ribosome most likely lead to a stop of protein translation at the ribosome build in two amino acids into the growing polypeptide chain instead of one prevent the release of the amino acid from the tRNA in the P-site of the ribosome
Which of the following statement about mRNA is TRUE? Question 12 options: mRNA splicing is a conserved process in both prokaryotes and eukaryotes. Post-transcriptional regulation of gene expression may occur outside of the nucleus in eukaryotes. In eukaryotes, mRNA maturation requires 5'-capping, splicing and the addition of poly A tails. mRNA is transported out of the nucleus for translation in eukarytotes.
Which of the following statements about translation is false? In eukaryotes, the 5' cap and the 3' poly(A) tail are involved in translation initiation. Peptidyl-transferase activity during translation is the property of a ribozyme. A base at the first position of an anticodon on the tRNA would pair with a base at the third position of the mRNA. The growing peptide chain is transferred from the tRNA in the P site to the tRNA in the A site. Ribosomes move along an mRNA in the 3’ → 5' direction.
What is the correct order for the movement of tRNAs through the sites on the surface of a ribosome?Question 32 options: A > E > P E > A > P A > P > E P > A > E E > P > A
How does the antibiotic streptomycin inhibit bacterial translation? Multiple Choice blocks elongation by preventing the large ribosomal subunit from binding to the small ribosomal subunit interferes with the normal pairing of aminoacyl TRNAS and codons resulting in abnormal proteins prevents the release of the initiator tRNA from the P site, blocking elongation blocks termination by competitively inhibiting the binding of a release factor to the A site
Which of the following statement(s) about the tRNA molecule is NOT correct? Question 39 options: tRNA is the cellular "interpreter molecule"; plays a crucial role in the translation of the genetic code into an amino acid sequence tRNA molecules have a complex 3-dimensional structure resembling an "L" 't' stands for transfer, because tRNA molecules transfer cellular amino acids to the ribosome aminoacyl-tRNA molecules are mostly found in the nucleus of a cell each tRNA has an amino acid-binding site as well as an anti-codon site
The piece of eukaryotic mRNA below includes the region that codes for the binding site for the initiator tRNA needed in translation. 5'-GUUUCCCGUAUACAUGCGUGCCGGGGGC-3' Using the table below, which amino acid would you expect to be on the tRNA that is the first to bind to the A site of the ribosome? AGC AGA AGG GCA CGA CUA GGA GGC GCC CGC AUA CUC AGU CCA UCA ACA CCC UCC ACC UUC CCG UCG ACG UUU CCU UCU GCG CGG GAC AAC UGC GAA CAA GGG CAC AUC CUG AAA GCU CGU GAU AAU UGU GAG CAG GGU CAU AUU CUU AAG AUG Ala Arg Asp Asn Cys Glu Gin Gly His lle Leu Lys Met Phe Pro Ser O methionine O arginine O cysteine Ovaline UUA UUG OOOO GUA GUC UAC GUG ACU UGG UAU GUU Thr Trp Tyr Val UAA UAG UGA stop
Which of these molecules has multiple partial charges and thus is most soluble in water? B H HHH HHH ABCD or E CH H CHOH D CH OH A cell is specialized in producing oil and steroid hormone. Which structure would be found in large r cell? O vacuoles O peroxisome O rough endoplasmic reticulum O smooth endoplasmic reticulum The oxygen released from photosynthesis results from: Reduction of NADP* to NADPH Chemiosmosis Oxidation of water Photophosphorylation
What is the function of polyadenylation in eukaryotes? (Choose all that apply) It moves ribosomes along MRNA during translation. It aids in the termination of translation. It stabilizes the resulting MRNA by limiting degradation at the 3' end of the molecule. It forms peptide bonds. It charges tRNAS It aids in the initiation of translation. It stabilizes the resulting MRNA by limiting degradation at the 5' end of the molecule.
Consider this list (below) of steps involved in translation. These steps are out of order. TRANSLATION: 1. the small and large ribosomal sub-units unite2. two amino acids join together.3. another tRNA anti-codon bonds with another mRNA codon 4. an initial tRNA bearing a specific amino acid arrives at the ribosome 5. the process continues until a protein molecule is completed6. at the synthesis site, initial mRNA codons are inserted
Indicate which of the following items are associated with transcription or translation. This could be in prokaryotes or eukaryotes, or both. Group of answer choices: Translation OR Transcription Sigma binds to the promoter mRNA binds to the small ribosomal subunit Spliceosomes remove introns and splice together exons Nucleotides are added from the 5' to 3' end tRNA anticodon binds to the corresponding mRNA codon STOP codon results in termination