In the figure below, mitosis is represented by which number? Also which number represents DNA synthesis?

Q: Work on peer support meeting reflection paper for drug continuum

A: The drug continuum refers to the range of drug use, from non-use to problematic use, and includes…

Q: question--The dairy industry uses enzymes to breakdown lactose in milk, especially for those who…

A: The dairy industry makes milk and things from milk, like cheese and yogurt. It's a big business that…

Q: Which of the following is true under the following conditions: The enzyme concentration is 8 nM, the…

A: The KM (Michaelis-Menten constant) is a measure of the affinity of the enzyme for its substrate. It…

Q: 6) The host (human) protein that serves as the virus receptor is: The normal function of this human…

A: Coronavirus: The coronavirus, also called the SARS CoV -2 virus, is responsible for causing the…

Q: Using xylitol what happen to in bottle using yeast at 25c and 45c

A: Xylitol is a type of sugar alcohol that is commonly used as a sugar substitute in various foods and…

Q: the name of the intramolecular structures that RNA can form is called a. hairpin b. supercoil c.…

A: Ribonucleic Acid, also known as RNA, is a class of biological molecule that is crucial for both…

Q: What happens to somatostatin levels after a meal?

A: Somatostatin is a peptide hormone that is produced by specialized cells called delta cells, which…

Q: Will Beta-lactam antibiotics disrupt cell wall formation in Domain Archaea? • A. No as Archaea do…

A: Antibiotic is an anti-microbial substance which kill or restrict microbial growth. Their…

Q: describe the transport and kinetics of thyroid hormones in the blood

A: Hormones are chemical messengers produced by glands or cells in the endocrine system that are…

Q: Transduction plates Please find the experimental plates prepared for you from 4 mutati lacZ:: kan…

A: Transduction is when a virus called bacteriophage transfers genetic material from one bacteria to…

Q: 1- Individual 13 decides he wants children and marries a woman is not affect or a carrier for…

A: Genetics helps us understand the fundamental causes of illnesses and disorders. By considering…

Q: Consider the following original coding sequence of a gene that codes for a short 5- amino acid…

A: A non-conservative missense mutation is a type of point mutation that results in the substitution of…

Q: Translate the following mRNA transcript   5’CGCCGAUGCGCGAUAUGUGGUAA’3   A. RRCAICG   B. ADARYVV   C.…

A: mRNA, or messenger RNA is a type of RNA (ribonucleic acid) that plays a crucial role in the process…

Q: which part of the brain is affected when heart rate increases during exercise

A: The medulla oblongata is a part of the brainstem, located at the bottom of the brain, where it…

Q: 1-The number of CAG repeats in the Huntingtin gene can be increased in children of people with…

A: Inheritance pattern is a type of pattern which determines how traits are passed from parental…

Q: D-amino acids are not coded for by DNA so how do bacteria acquire them? • A. They use a racemase O…

A: D-amino acids are not coded for by DNA so how do bacteria acquire them?   The answer will be . They…

Q: The image shown is an example of what kind of channel? Nat O A. ligand-gated ion O B. voltage-gated…

A: Ions channels are the transmembrane protein structure that allow passage of molecules.  There are…

Q: Problem 2 3. In Drosophila, two red-eyed, long-winged flies are bred together and produce offspring…

A: Alleles are the alternative forms of a gene that are located on the same locus of a homologous…

Q: The use of cryoprotectants can interfere with normal metabolic processes in cells and tissues,…

A: Homeostasis is the ability of an organism or a system to maintain a relatively stable internal…

Q: Imagine that you have done a cross between two strains of yeast, one of which has the genotype A B C…

A: The scoring patterns in both tetrads indicate that recombination has occurred between genes A and C,…

Q: Briefly compare in vivo enzyme systems to in vitro enzyme systems for the testing of ecotoxicology.…

A: Specialized proteins called enzymes catalyse or speed up chemical processes in living things. They…

Q: what is active ingredient, mode of action and level of activity in Bleach

A: Bleach It refers to a strong and effective disinfectant that can be used to kill bacteria, fungi,…

Q: Give a brief overview of the role leptin might have on puberty.

A: Leptin is a hormone produced by adipose (fat) cells that plays a crucial role in regulating appetite…

Q: estion 21 Which of the following is true of bacterial ribosomes? O Proteins are synthesized using…

A: Bacteria are unicellular organisms that are characterized by a simple cellular structure. The…

Q: A diagram displaying the different levels of organisation of the nervous system

A: The nervous system is a complex network of cells and tissues that work together to transmit signals…

Q: If the pH of human blood becomes higher than the average pH of 7.4, what must have occurred and what…

A: pH is a measure of acidity or basicity of a solution. If there are more H+ ions, the solution will…

Q: Which pair of restriction enzymes will you use to insert EGFP gene from Addgene Vector 174028 in…

A: Restriction enzymes, also known as restriction endonucleases are enzymes that recognize and cut DNA…

Q: What are wetlands? Describe how they preserve water quality.

A: Wetlands are ecosystems that have water present in them on a permanent or seasonal basis. These are…

Q: What is the role of the indirect pathway of the basal ganglia thought to be? To inhibit all movement…

A: The basal ganglia are a group of subcortical nuclei (clusters of neurons) located deep within the…

Q: The toolkit genes generally regulate_____ [A]_____ in order to direct development. Other…

A: The Central Dogma of molecular biology is a framework that describes the flow of genetic information…

Q: 3. What are the expected genotype and phenotype ratios in the following genetic conditions? Use…

A: Dihybrid cross is a cross between two hybrid individuals with two traits. Below is the table for…

Q: 1-Recent testing has determined that Kate Middleton (the wife of Prince William) is a carrier for…

A: Note: “Since you have posted multiple questions, we will provide the solution only to the first…

Q: Answer by listing only the name of the disease.  Some questions will require the name of the…

A: Microorganisms like bacteria, viruses, parasites cause various diseases in our body. Some bacterial…

Q: Q1: Which one of the following electron transporters does not contain iron (Fe+++)? O NADH…

A: NADH and FADH2 are the two molecules produced by citric acid cycle. The NADH and FADH2 produce ATP…

Q: Topic: Allergic reactions. Hypersensitivity of the immediate type Plan: 1. Classification of…

A: An allergic reaction is a type of reaction that our immune system has when our bodies come in…

Q: What is the optimal growth conditions of total coliforms in freshwater. Discuss it in detail (such…

A: Total bacterial count (TBC) refers to the total number of bacteria present in a given sample or…

Q: What is the process, from chapter 5, that allowed bacteria cells to acquire new traits? Such as…

A: Traits refer to any characteristic or feature of an organism that is determined by its genes. These…

Q: Drug continuum worksheets

A: The worksheet shows how someone goes from using a substance to stopping completely. At each point,…

Q: why is the New Ecological Paradigm scale important?

A: Ecology is the study of how organisms interact with each other and with their physical environment.…

Q: summarise the effects of cortisol and the tissues it acts upon.

A: Cortisol It is defined as a steroid hormone that is produced by our adrenal glands which are…

Q: How would you go about cloning this amplified DNA into pL4440？Using your knowledge of cloning…

A: Cloning is the process of creating genetically identical copies of a biological entity, such as a…

Q: If you wanted to study olfactory signaling, what is another gene you could mutate and what would you…

A: The olfactory system is the sensory system responsible for detecting and processing odorants which…

Q: Which of the following best describes the impacts of antigenic variation? Mark all that apply.    A.…

A: Genetic variation refers to the differences in the genetic makeup (DNA sequences) among individuals…

Q: 5. When TSIA agar is inoculated with Salmonella typhimurium, the bacteria are growing in the butt of…

A: Agar is a type of gelatinous substance derived from red algae. It is widely used in microbiology as…

Q: TATAAAA A > > > > +1 B Start codon 5'-UTR 3'-UTR ↑ D ATG ←E Stop codon ↑ Polyadenylation signal E…

A: Transcription is the process by which genetic information encoded in DNA is copied into RNA. It is…

Q: Sharks live in marine (saltwater) habitats and are osmoconformers. Based on this information which…

A: This question relates to the osmoregulation abilities of sharks, which are marine osmoconformers.…

Q: 1. Small intestine vs Large intestine > Compare the two when it comes to function. Compare different…

A: An organ system is a group of organs that work together to perform a specific function in the body,…

Q: write a paragraph on why short acting bronchodilators, nebulizer/ inhaler or volumatic/chambers are…

A: Spirometry is a common lung function test that measures the amount of air a person can inhale and…

Q: What is the probability that their fourth child to have CF? • What is the probability that their…

A: The genetic disorder Cystic Fibrosis (CF) affects the respiratory, digestive, and reproductive…

Q: Question #15 Make a prediction. Which mutation types do you think will most likely cause the biggest…

A: A protein included in a basic biological action, such as DNA repair or cell division, that's encoded…

Oogenesis

The formation of the ovum (mature female gamete) from undifferentiated germ cells is called oogenesis. This process takes place in the ovaries (female gonads). Oogenesis consists of three stages known as the multiplication phase, growth phase, and maturation phase. 

Cell Division

Cell division involves the formation of new daughter cells from the parent cells. It is a part of the cell cycle that takes place in both prokaryotic and eukaryotic organisms. Cell division is required for three main reasons: