In TLC, point of origin refers to O The bhottom edge of the TLC plnto.

Q: Which of the following factors DOES NOT affect retention time of a sample undergoing normal phase…

A:

Q: Calculate the Re value for a spot in a TLC experiment if the solvent moved 14.5 cm and the spot…

A: Given  Distance moved by solvent =  14.5 cm  Spot of Compound moved  from the origin = 6.1 cm  Rf =…

Q: The obtained plot in the detector of HPLC is called, O peak O bell O triangle area

A: HPLC stands for high performance liquid chromatography which is a separation technique and the…

Q: What is 2D gel electrophoresis

A: 2D gel electrophoresis is a technique for detection and separation of proteins. It is a combination…

Q: Show TWO (2) characteristics of the core enhanced technology that contribute to better separations,…

A: A question based on analytical separations that is to be accomplished.

Q: Which is better HPLC system Agilent 1290 Infinity II LC or Nexera Series UHPLC? Explain

A: HPLC is High Performance Liquid Chromatography UHPLC is Ultra High Performance Liquid Chromatography

Q: The following data were obtained by GC on a 40 cm packed column. ( VM: 1.28 mL, Vs: 0.65 mL)…

A: Solution:

Q: How to improve the sensitivity and selectivity of AFS for Hg detection? Please explain.

A: If we increase the intensity of excitation source in AFS ,  high sensitivity will be…

Q: Which technique measures secondary structure? a. Size exclusion chromatography b. Circular Dichroism…

A: The secondary structure is formed by bending of the 1o structure. In this, an intermolecular force…

Q: C. >) Order the compound A, B and C from lowest to highest Rr. The sample is spotted on a silica gel…

A:

Q: Calculate the melting temperature (TM) for the GFP primer- CATGGTCCTGCTGGAGTTCGTG (please give…

A: In DNA sequencing, A compliments T whereas G compliments C ( Chargaff Rule). The formula for…

Q: 12. This detector is not used in HPLC: a) ECD b) MS c) Fluorescence d) RI

A: Mixture components are estimated using HPLC detectors. The actual separation in HPLC (High…

Q: What would happen to the retention time of a compound if the followingchanges were made?a. Decrease…

A: Chromatography is the technique to separate components of a mixture.

Q: Explain in detail how we optimize chromatographic seperations?

A: Solution The contribution is geared toward the event of methodology that permits to contemplate…

Q: Define the following terms used in HPLC:             (a) gradient elution             (b)…

A: Given terms, (a) gradient elution (b) isocratic elution (c) reversed-phase packing

Q: How does the wavelength in chromatogram affect the signal intensity in an HPLC

A: wavelength in chromatogram affect the signal intensity in an HPLC explanation is given below.

Q: columns of equal length (time in min). Column 1 Column 2 10 suodsa opaad

A: Answer. For Component A we have 8-1.2 = 6.8

Q: ) In What order Ufrom highest Rf tolanest Rf) wonld you edpeet to fina 3 compardy Shopn below on a…

A:

Q: For GC analysis, the following can cause band broadening and poor resolution OUse of automatic…

A: Chromatography is separating technique for mixtures into it's components. It is based on the…

Q: What are the advantages of using a multidimensional HPLC separation for the analysis of complex…

A: Since you have asked multiple questions, we will solve the first one for you. For remaining…

Q: ii) What are the adjusted retention times for components A and B? iv) What is the relative retention…

A: 3 . For component A = 8-1.2=6.8 For component B = 10-1.2 = 8.8 4. Separation factor = 1.29

Q: Sort the following molecules in order of increasing Rf value assuming a normal-phase silica TLC…

A: Here, TLC plate was used with a 10 : 1 hexane:ethyl acetate solvent system which is non-polar.…

Q: What happen  to the separation raid (RS) in HPLC if I change the mobile phase from methanol/water…

A: Given: We have to tell the effect of polarity on the separation rate in HPLC.

Q: 1. Please explain the difference between parallel and antiparallel B sheet. Which one has tp…

A: As per the guide line, Since you have asked multiple questions, we have solved the first question…

Q: what are advangtage and disadvantage of using an Atomic Force Microscopy and explain each

A: Atomic force microscopy is a technique by which we study the different type of surfaces like…

Q: List the desirable characteristics of HPLC detectors.

A:

Q: What is the application of chromatography (HPLC) and it's mechanism ?

A: Answer.

Q: could products be isolated for further analysis suing TLC (thin-layer chromotography) as a…

A: Chromatography is a laboratory technique for the separation of a mixture into its components. The…

Q: The total retention time of dodecane on a 15 m x 0.25 mm i.d. DB-5 GC column was 8.0 min. The column…

A: Given: Number of theoretical plates=N=25600Retention time=tR=8.0 min

Q: the efficiency of a chromatographic column improves the measure that a.increases the height of the…

A: To determine what improves the efficiency of a chromatographic column:

Q: Question attached

A: Chromatography is a technique that is used to separate components of mixture.

Q: What is the retention factor of a sample when after injectiion the void time (tM) took 4.18 sec? The…

A:

Q: state/hexane, the sample showed a single spot at 3.4 cm (relative to vent had risen to 7.1 cm…

A: TLC ( thin layer chromatography) is the technique used in chemistry laboratories to identify the…

Q: Compare gradient and isocratic mode in HPLC.

A: Gradient and isocratic mode in HPLC are the two different modes of operating condition in HPLC.

Q: or non provid- a) PCI- c) OF

A: This question is related to Lewis structure.

Q: How can you ensure “good quality” peak separation in high performance liquid chromatography (HPLC)?

A: In HPLC , different kind of columns are used to separate to isomers. So, here by using trial method…

Q: In thin layer chromatography, changing the mobile phase will alter the Rf value of a compound. O…

A: This can be solved as follows

Q: Two components in an HPLC separation have retention times that differ by 15 s. The first peak elutes…

A: The base number of hypothetical plates under given conditions ought to be resolved to utilize the…

Q: what chromatography seperation how is tlc part of it

A:

Q: Which is NOT a factor that affects retention time? I. the pressure used II. The nature of the…

A: the retention time will vary depending on: the pressure used (because that affects the flow rate…

Q: Different from GCMS, why is an interface needed when coupling HPLC with MS?

A: In addition to the liquid chromatography and mass spectrometry devices, an LC-MS system contains an…

Q: Calculate the Rf value of the Blue spot on the TLC Plate below. (answer must have * 2 decimal…

A: Calculate Rf value of the blue spot on TLC.  From the figure,  Distance travelled by the solvent…

Q: What is the retention factor of a sample when after injectiion the void time (tM) took 4.73 sec? The…

A: Answer: Retention factor is equal to the ratio of difference (between retention time and void time)…

Q: which of the folowing(s) is/are true ?  1 split ratio in GC is a ratio of sample passed to column…

A: Column resolution increases with increase in length and decrease in diameter.

Q: UVVIS spectrophotometry

A: Correct: A

Q: Please describe possible sources of error in HPLC experiments - systematic and random and how they…

A: HPLC(High performance liquid chromatography) Errors in HPLC can be systematic and random. Systematic…

Q: in high preformance liquied chromarography, what is a Bi phenyl , and what its application and…

A: Generally, C18 columns offer the ability to resolve a wide variety of analytes without issue.…