Lab 5: Reproductive Cell Division - Meiosis 9) The accompanying pedigree is for a rare, but relatively mild, hereditary disorder of the skin.com/ I 1 1 ede OT OT 100 stroni -თემ 66 this trail 366066 To Awey sot
Q: Crossing over is an event occurring during metaphase II. True False
A: Crossing over is a cellular process that happens during meiosis a special type of cell division that…
Q: Why is it difficult to directly observe succession in most ecological communities? BIUG 14 >
A: Ecological succession is the mechanism of transformation in an ecological community's species…
Q: Matter is continually recycled between abiotic and biotic components of Earth's ecosystem in…
A: The nitrogen cycle is the biogeochemical cycle by which nitrogen is converted into multiple usable…
Q: A hyperpolarized cell can be generated when: Group of answer choices A. ligand-gated ionotropic…
A: Introduction Ionotropic receptors, also known as ligand-gated ion channels (LICs, LGIC), are a…
Q: 3. Despite your chaotic nature, you various types of RNA species (molecules) following their…
A: rRNA is a ribonuclic achid which is synthesized inside the nucleus of the cell.
Q: E. it can be used on hair and In anaerobic fermentation pyruvate is further oxidized to lactate or…
A: During aerobic respiration, by the process of glycolysis glucose molecule is broken down into form…
Q: Compare the appearance of the "e" when viewed with the naked eye to its appearance when viewed under…
A: Introduction: - Microscopes are optical devices used to magnify an object. They are commonly used in…
Q: Cell body Effector Spinal nerve Central canal Dorsal root Interneuron Motor neuron Sensory neuron 14…
A: Neurones are the largest cell of our body which help in transmission of signal all over the body.
Q: 1. In the 1950s, many scientists thought that proteins, not DNA, carried genetic information. a. Why…
A: Note:- Sorry, as per the honor code we are allowed to author only the first three questions unless…
Q: Problem 2: The accompanying pedigree is for a rare, but relatively mild, hereditary disorder of the…
A: * If the trait is dominant, then one of the parents will have the trait. Dominant traits usually not…
Q: hidden message of the cide: 5' - UGAUGAUGAUGAUGCAUGCUAACGAUUCCGCAAUGUCGAUAUCAAUACGUUGACC-3'
A: The structure and function of the entire body are controlled by DNA. It is present in every cell. It…
Q: Kate and her husband are both heterozygous for galactosemia gene. If Kate and her husband have four…
A: A group of hereditary disease known as galctosemia which means galactose in blood. Undigested…
Q: Expansion microscopy technique beats the 0.2 um resolution limit of optical microscopy by improving…
A: Microscopes are instruments that allow enlarged visualization of biological specimens. They work on…
Q: Homozyogous wild type male Drosophila PPQQRRSSTTUUVV (all linked) are irradiated to induce the…
A: Genes are small units of heredity, a different version of the same gene is known as its allele.…
Q: Of what value is Gram staining?
A: Gram staining is a method frequently used to distinguish between two sizable groups of bacteria…
Q: 1. What is the nature of spore-bearing hyphae of the following: (tell whether it is enlarged tip,…
A: introduction : The long filamentous branching present in fungus and actinobacteria, known as hypha,…
Q: Describe the relationship between non -muscle myosin ,actin and growth cone extension.
A: When cells receive and react to signals from other cells to support various bodily activities, such…
Q: 11. How are metaphase 12. If cells in the process of dividing are subjected to colchicine, a drug…
A:
Q: How do I make a Calibration plot with this?
A: Graphs or plots are generally used to organize the data. It also helps to tell the relationship…
Q: fermentation catabolic or anabolic
A: Introduction: In an anaerobic environment, enzymes are used in the chemical process of fermentation…
Q: Is tofu a biotech product? Yes or No. Why?
A: Is tofu a biotech product? Yes or No. Why?
Q: Explain why, in the presence of unfavourable conditions like poison or antibiotics, the bacterial…
A: Molecules that precisely target and kill cells are known as antibiotics. The inhibition or control…
Q: Xanthoproteic test is used to detect amino acids containing an aromatic nucleus in a protein…
A: Introduction Organic substances known as amino acids have both functional groups for amino and…
Q: A man, heterozygous for type B blood marries a woman with type A blood whose father was type O. What…
A: A man, heterozygous for type B blood marries a woman with type A blood whose father was type O. What…
Q: rve, and label its structures. 1. algu o p Drawing of Amoeba steh Paramecium -- Paramecia are quite…
A: Amoeba and Paramoecium both are eukaryotic unicellular protozoan protist that shows a…
Q: Describe the process of chemical digestion of our three major macronutrients, carbohydrates,…
A: Chemical digestion is the breakdown of food with the help of enzymes. Enzymes are released by…
Q: If you have chosen the objective lens with 10x and the ocular lens magnification is also 10x. Then…
A: Introduction Magnification is the process of enlarging something's perceived size—not its actual…
Q: Multiple Choice Question: Which of the following sensory structures of insects can detect air- or…
A: Insects are among the most significant animals on the planet. They participate significantly in…
Q: You are assessing the impact of a removal of a parking structure that now allows gene flow between…
A: Gene frequency or allele frequency is the number of times (or frequency) a particular allele occurs…
Q: Using figure (a) above as guide, list the five components in the CRISPR-Cas9 bacterial defense…
A: CRISPR is a acronym for Clustered regularly interspaced short palindromic repeats. It forms a very…
Q: Describe and understand catechol oxidase activity
A: Introduction :- Catechol oxidase is a type 3 di-copper cofactor-containing copper oxidase that…
Q: Identify each cell below as prokaryotic, plant cell, or animal cell, then identify the labeled…
A: The fundamental building block of life is the cells. All living things are constructed from many…
Q: The contents of a plaque may not always contain a clonal population of phage if: a. Identical…
A: Plaque:- phage infected bacterium usually burst and releases a number of daughter phages which…
Q: Of what importance are spore-forming bacteria in the food industry?
A: Food industry is the fastest growing industry nowadays. This industry have explored a lot of…
Q: Which of the following statements are is true about the distribution of hermatypic corals? They…
A: Corals are created by organisms from the Phylum Coelenterata Coral reef is a habitat to many other…
Q: Discuss salient features of protozoan
A: Protozoans are the tiny, unicellular and microscopic organisms that contains complex structures with…
Q: our raw sequencing data, from two reactions, are given: 5'-ACCGTCGGTTACGCTTAGA-3'…
A: A) One Sequence Read as per data: GTTACGCTTAGA B) One Sequence Contig: ACCGTCGGTTACGCTTAGATAACAAG
Q: Successful bacterial DNA replication does NOT … please explain the answer choice a.ligate DNA…
A: Introduction :- All living things require primers, which are brief, single-stranded nucleic acids,…
Q: Jean taps Mike on the shoulder to get his attention. Which type of receptor alerts Mike's brain that…
A: Receptors are organ or cell able to respond to light, heat, touch or other external stimulus and…
Q: The exchange of gases in our lungs is through osmosis Ophagocytosis diffusion adhesion O…
A: The exchange of oxygen and carbon dioxide occurs in very tiny air sacs called alveoli. Alveolar…
Q: The post-translational OA. is performed by OB. is removed by phosphatases. OC. can activate or in…
A: Translating a code simply involves changing it from genetic code to proteins. The initiation and…
Q: Sperm motility is one of the features of any fertility test. The movement of human sperm is possible…
A: Introduction In anisogamous forms of sexual reproduction, the male reproductive cell, or gamete, is…
Q: What are three functions of the cell nucleus? What are two functions of a plant cell vacuole?
A: Introduction: Nucleus: The largest and most noticeable organelle inside the cell is the nucleus. The…
Q: Chemical reaction Produces ATP in all life forms Photosynthesis Chloroplast into Solar energy stored…
A: Photosynthesis is a process by which autotrophs convert light energy into chemical energy, which is…
Q: Plasma IL-12, IL-17, IL-18 and IL-4 concentrations of 36 Systemic Lupus Erythematosus (SLE) patients…
A: Systemic lupus erythematosus (SLE). The most common type of lupus It is an autoimmune disease in…
Q: 1. Draw a gel showing the bands/fragments generated from cutting the plasmid below with Sall, BamHI…
A: DNA or proteins are separated via gel electrophoresis based on their molecular weight. It makes use…
Q: An abnormal gene on the X-chromosome causes one sister to live with haemophilia A, but her identical…
A: Haemophilia is a bleeding disorder, caused by a mutation in one of the genes, that provides…
Q: H B H H A H H What do we call the bonds labelled A and B? O Covalent bond, hydrogen bond O Hydrogen…
A: Water is a polar in nature and made up of 2 hydrogen and 1 oxygen molecule , water is used in…
Q: Classify each of the characteristics based on whether it describes autotrophs or heterotrophs.…
A: Food chain involves the transfer of energy from one trophic level to the other trophic level.On the…
Q: Discuss the permeability of the phospholipid bilayer to the molecules and ions listed below. Is the…
A: The phospholipid bilayer from the plasma membrane or any biological membrane in a cell. The plasma…
Step by step
Solved in 2 steps
- Is cystic fibrosis a genotypic or phenotypic change? Explain your reasoning. Edit View Insert Format Tools Table, 12pt v Paragraph BIU A 2 T?くO Canvas Dr. Pass Question 22 Observe the karyotype below to answer the questions. く)1 ( 3 2 器 11 20 身S a8 16 10 88 85 21 1. Is this person biologically male or female? 2. What is the proper term for the anomaly displayed in the karyotype? 3. How does this anomaly occur? During which stage(s) of meiosis? Edit Format Table 12pt v Paragraph v U Aing x School Employee x Student Records | RACC arning.com/index.cfm?method%3cResource.dspView&ResourcelD=1070&ClassID=3856718 3. Which healthy gamete could not result from the parent cell shown? |c 1f A. Gamete A B. Gamete B C. Gamete C D Gamete D A,
- /d/1n5NtidRwTwUzcDkDPi5Z9P_SHPZ91A-XH-pfftLbhNc/edit (1) O pols Add-ons Help Last edit was seconds ago BIUA ミ: 12 + ext Calibri I|1 6 I 2 Section 5: Trihybrid cross and Laws of probability For a trihybrid cross, in which inheritance of alleles for three genes is tracked, drawing a Punnett square that combines all three genes may not be practical. Instead the laws of probability may be used. The product law of probabilities says that when alleles for separate genes segregate independently, we can figure out the probability of a particular combined genotype by multiplying the probability of the alleles for each gene. 13. We cross a homozygous tall pea plant with yellow, round seeds to a homozygous dwarf pea plant with green, wrinkled seeds. All the F1 offspring are all tall plants with yellow, round seeds. a. What are the expected F2 ratios (use fractions) of tall and dwarf plants? b. What are the expected F2 ratios (use fractions) of yellow and green seeds? C. What are the expected F2…Which term describes chromosomes whose centromeres are located at the end of the chremosome? Humans have no none of these. Ometacentric O acrocentric O telorentric O helacentricthe offspring ès) can often be autosomal I 1.1 III ad amalg od no IV 9 OTO 5 0000 anivellor and goje If individual 2 were to marry a woman with no family history of the disease, which of the following would most likely be true of their children? a. All of the children would have the disease. b. None of the children would have the disease. c. Only the sons would have the disease. d. All of the sons would be carriers of the disease. e. None of the daughters would be carriers of the disease.
- d/1n5NtidRwTwUzcDkDPi5Z9P SHPZ9IA-XH-pfftLbhNc/edit 1) @ Is Add-ons Help Last edit was 15 minutes ago | Calibri в I UA 12 + 3I | II 6 1 I 7. Construct a Punnett square for a cross between two heterozygous pea plants with violet flower color. a. What genotypes would you expect in the offspring? b. What percentage or ratio of each genotype would you expect in the offspring? !!!Tell me whether it is autosomal reccessive inheritance,autosomal domiant inheritance,sex-linked reccessive inheritance, sex-linked dominay inheritance or y-linked inheritance based on information given.(With Pedigree Anlaysis Breakdown)Choose the best matching phrase in the right columnfor each of the terms in the left column.a. meiosis 1. X and Yb. gametes 2. chromosomes that do not differbetween the sexesc. karyotype 3. one of the two identical halvesof a replicated chromosomed. mitosis 4. microtubule organizing centersat the spindle polese. interphase 5. cells in the testes that undergomeiosisf. syncytium 6. division of the cytoplasmg. synapsis 7. haploid germ cells that uniteat fertilizationh. sex chromosomes 8. an animal cell containing morethan one nucleusi. cytokinesis 9. pairing of homologouschromosomesj. anaphase 10. one diploid cell gives rise to twodiploid cellsk. chromatid 11. the array of chromosomes in agiven celll. autosomes 12. the part of the cell cycle duringwhich the chromosomes are notvisiblem. centromere 13. one diploid cell gives rise to fourhaploid cellsn. centrosomes 14. cell produced by meiosis thatdoes not become a gameteo. polar body 15. the time during mitosis whensister chromatids…
- Explain the sex-linked traits. (S9LT-ld-29.4.4) Solve problems related to sex-linked traits. (S9LT-ld-29.4.4) WHAT I NEED (MATERIALS) • Worksheet • Pens WHAT TO DO (PROCEDURE) PART A Directions: Tell whether the following carry or show the sex-linke recessive spongy-tiny pores trait. Also, tell whether the individuals a male or female. Remember that since most sex-linked traits are recessive, the person w shows the trait can have no X's with big superscripted letters. So, if a m carries the trait, he must also show the trait. XDY XDXD XdY Carrier? (Yes or No) Has the Trait? (Yes or No) Male or Female Phenotype or Appearance of the Individual ided Questions: 1. What chromosomes will result to a normal phenotype (normal spongy po trait12Tall, Axialnuot ert tna apnibnit alsbneM aneg s ni tisTI s to 2ovitsnietis e1s aelellA Then, perform a cross to determine the genotype and phenotype of the offspring. B. Determine the genotype of the gametes that will come from parent 1 and parent 2. Parents (2) TtAa the tr (1) TtAa Phenotype Tall, Axial D deirw efoug for the Gamete genotype s awon ai selelle emse erti liw ensp A vidual wi resa it. alells ins1sib riliw eneg oakns oRhters. vrld ertt of elei isi miel e ai sqyioner9 JBubivibni ns -X 30 tw Ned st o enmol Jer cenimaob isi 2elellelo isa brtt oi aete egytonea beea9 sewoda eepibeg A fassni to at s pniwollot vileuau nentons ot nolisonag Genotype of Offspring: Phenotype:eMitosis and Meiosis: Mastery Tes X a 1.app.edmentum.com/assessments-delivery/ua/mt/launch/3747/10 JuZXitdWikvc2Vjb25kYX. Q e * * e MCPS Bookmarks Home | Schoology C Clever.com e ONLING CLASSES E Reading list Next O Mitosis and Meiosis: Mastery Test O Submit Test + Tools O Info Select the correct answer. Marcus is admitted to the hospital for a bone marrow stem cell transplant from hs brother. What will happen after his brother's stem cells are transplanted into Marcus? OA. The stem cells will divide through meiosis to create haploid stem cells. O B. The stem cells will divide through mitosis to create diploid stem cels. OC. The stem cells will divide through meiosis to create diploid stem cells. OD. The stem cells will divide through mitosis to create four haploid daughter cells. Reset Next 732 PM 4/22/2022 O 2022 Edmentum. All rights reserved. O Type here to search