Let's Think Critically 1. Would you argue that viruses are alive? Why or why not? Base your answer on the structure and mechanism of reproduction of viruses. from the mother? Justify your answer by citing references.
Q: Provide a scientific example of evolution and/or natural selection. You can use human and/or animal…
A: Let us understand the process of evolution and the changes during evolutionary phases by an example…
Q: __________ is a substance secreted by cells in the lungs that reduces surface tension.
A: Surface tension is the cohesive force that take place between a liquid-gas or liquid-liquid…
Q: Describe rubella and rubeola.
A: Rubella- It is a viral infection which is also called German measles or three day measles. It is a…
Q: 12.In a zygote that begins with a complement of two homologous chromosomes pairs, A and a, and B and…
A: Introduction :- A gamete is a female or male sperm or an egg cell, to put it simply (male gamete).…
Q: Where would you level of Muscle Want higher / finer Control?
A: Muscle Contraction can be described as a process in which tension is generated within muscle cells.…
Q: T4
A: We know that The digestive system in humans is a long hollow tube that has an inlet (mouth) and an…
Q: C- Find the vital capacity for a person with a total lung capacity of 7 L and a residual volume of…
A: Vital capacity can be defined as volume of air exhaled after maximal inhalation. While Total lung…
Q: Which of the following is true about the innate immune system? Check all that apply Phagocytosis…
A: Immunity is defined as all of the physiological mechanisms that allow a person's body to recognise…
Q: 54
A: We know that The anterior pituitary gland releases a peptide hormone known as prolactin. It helps in…
Q: What causes the inflammation of acne vulgaris?
A: Acne vulgaris is a skin disorder. It has been seen on the face. Acne vulgaris is a chronic skin…
Q: The genotype of the individual with the arrow is O O A) Aa B) Xaya C) xAxa D) aa 10 마음 게
A: Inheritance or heredity is passing on one trait from the parents to the progeny by either asexual or…
Q: Name four process controls and their importance. (related to medical laboratory)
A: Introduction : Process control is the statistical regulation of the process within the upper and…
Q: What step in the scientific method follows experimentation?
A: Introduction The scientific method of research is a process that involves various steps of…
Q: What causes diaper dermatitis?
A: The diaper dermatitis is a type of irritated skin on the bottom of the baby or the ones using the…
Q: Alabama's environmental issue
A:
Q: 1) What are tissues and what are the four main types of tissue? 2) Know functions and basic…
A: The study of people via the effects and interactions of many different academic disciplines,…
Q: True or false. The cell walls of plants prevent the process of cytokinesis.
A: Introduction Plant & Animal cell division Plant cell ~ divides by sedimenting a partition…
Q: Photosynthesis of C3 plants in hot conditions is more likely to be: O CO2 limited O Light limited
A: The photosynthesis is the process by which chlorophyll containing plants produce organic molecule…
Q: __________ is the information scientists collect when doing experiments and making observations.
A: a scientific procedure undertaken to make a discovery, test a hypothesis, or demonstrate a known fa
Q: (a) Explain the trend shown by the graph above. (b) Evaluate how effective an educational program or…
A: Diabetes mellitus refers to a group of diseases that affect how the body uses blood sugar (glucose).…
Q: Complete the table below. For each organelle, indicate whether it is found in an animal cell, a…
A: The components contained within a cell are known as the Cell Organelles. The eukaryotic cell…
Q: What are the genotypes of individuals 1, 2, 4, and 7? 9 OLOT 12 10 11 13 14 15
A: This a hungtingtons disease pedigree chart. Because of affected female are present. Using different…
Q: I need help answer quickly
A: Cells are the basic structural and functional unit of all known organisms which help in the process…
Q: 11 The diagram below shows a 'bathtub' analogy which is often used to help explain the…
A: Introduction : The study and analysis of the distribution, patterns, and causes of health and…
Q: The monomers that make up proteins are called_________.a. nucleotidesb. disaccharidesc. amino…
A: Proteins are the polypeptide chain, which folds into a three dimensional (3D) structure to…
Q: Label name and full explanation?
A: We know that The respiratory system consists of the nose, the pharynx, the larynx, the trachea, the…
Q: ucose monomers linked into a highly branched chain
A: Glucose is a smallest monomer of a carbohydrate. It is a six carbon molecule. Various monomers of…
Q: How are congenital abnormalities of the urinary collecting system detected and treated?
A: The word congenital means any trait or disease present from birth. Hence the diseases detected at…
Q: TAIL LENGTH NUMBER OF MICE
A: Introduction: Directional selection When an extreme phenotype is preferred over the mean trait, this…
Q: blackberries
A: In the above given experiment, the farmer grows the blackberries. Her the farmer observed that the…
Q: QUESTION 6 In bryophytes, the gametophyte is O the dominant generation O dependent on the sporophyte…
A: Bryophytes are plants placed under Phylum Bryophyta. Bryophytes lack true stems, leaves, or roots.…
Q: 3. Give the genetic content and chromosome number (n) of a diploid cell during the following phases:…
A: Mitosis is the cell division process that involves production of two daughter cells that are…
Q: QUESTION 3 When a bacterial cell with a cell wall is placed in salt water with a higher-solute…
A:
Q: 5 senses of taste
A:
Q: amino acid T
A: The Fischer projection is a two-dimensional representation of a three-dimensional organic molecule…
Q: 5. The symbiotic theory explains the origin of eukaryotic cells with the transition to aerobic-…
A: Introduction Eukaryotes are organisms having cells that contain a nuclear envelope around their…
Q: I need help don't copy
A: Immunity is resistance to disease. The two important components of immunity are innate and adaptive…
Q: How are chickenpox and herpes zoster related?
A: Chicken pox is the infection in which rashes develop which are quite itchy in nature, while herpes…
Q: 32. In a blood pressure measurement of 110/70, the number 70 is the ________. a. systolic pressure…
A: As We know that Blood pressure is illustrated as the force that is employed by the blood on the…
Q: How do we get concentration gradients in neurons? How can we test if these processes are active or…
A: Concentration gradient means that the substance moves from its higher concentration towards its…
Q: (i) Explain the effect of the ionising radiation on the bacteria. (ii) Identify the purpose of petri…
A: Given here is the effect of ionising radiation on the growth of salmonella typhimurium in the…
Q: Sugars starches and cellulose are all types of
A: Macronutrients are nutrients which our body needs in large amounts. These include - carbohydrates,…
Q: 4. What is mitrochondria?
A: We know that Cell is the basic functional and structural unit of every organism and is further…
Q: which of the following is true about the immune system? check all that apply. a. cd8 t cells…
A: Introduction The main function of the immune system is to protect us from foreign substances and…
Q: Check your understanding: Label and describe the function of each of the following structures: •…
A: Introduction : One of the body's sensory organs is the eye. The most intricate sense organs in the…
Q: A diploid male organism has two homologous chromosomes. A and B are from its maternal parent, while…
A: Introduction Mitosis and meiosis are cell division proces. Mitosis results in cloned cells while…
Q: Listen Spontaneous Mutations Can result from an error in the egg or sperm of a parent Can result…
A: Genes are made of nucleic acids called DNA. The variant forms of genes are called alleles. The…
Q: Regulated reabsorption of Na+ at the DCT occurs under the influence of the hormone
A: Introduction Kidneys are small bean-shaped organs present in the lower abdomen of the human body.…
Q: 767 B C A C T A A G G G (!!! : A D
A: DNA structure DNA is deoxyribonucleic acid , structures of DNA is double helix made of two…
Q: What factors determine glomerular filtration rate?
A: Glomerular filtration is the initial step in the process of urine formation. It filters the waste…
Step by step
Solved in 3 steps
- 1.List down some fundamental characteristics that are common to ALL cells and fundamental functions that are common to ALL cells. 2.Provide five key comparisons between the structure of prokaryotic and eukaryotic cells. 3.Compare/contrast the following mechanisms of prokaryotic and eukaryotic cells in terms of: •Reproduction •Locomotion •Metabolism1. The production of arginine is terminated by the presence of excess arginine. State which phenomenon is responsible for this outcome. Explain the phenomenon in brief. 2. Suppose, a group of scientists developed a recombinant enzyme having mutations in its active site. Do you think, the activity of an enzyme would differ from the wild type? 3. Which part of the cell has a model structure of a fluid mosaic? Why do you think this happens?12. The theory of endosymbiosis posits that mitochondria became organelles in eukaryotes after an engulfment event leading to a symbiotic relationship that was maintained throughout evolutionary history. What evidence supports the theory of endosymbiosis? a. Mitochondria have their own DNA b. Mitochondrial ribosomes are similar in shape and size to prokaryotic I ribosomes c. The presence of the double membrane surrounding mitochondria d. All of the above
- 1. Based on the presented properties of life, why are viruses considered non-living? 2. How do plants and animals are alike and are different in terms of ensuring their survival and adaption?5. Molecular Evidence. Cytochrome c is a protein located in the mitochondria of cells involved with cellular respiration. Compare each organism's Cytochrome CDNA sequences with the ancestor cell and each other. Circle or highlight the differences (mutations) present in the cytochrome CDNA sequences from ancestor cell. ANCESTOR CE A T TAGCGAC CAGTATATC CTACAATC C G T C TACTTCATTO ATTAGCGACCAGTT TATCCTACAATCC c GTCT ACT TCAT ATTATCG ACCAGT T TATC CTACATTCCC G TATACT TCGT EARTHWOR C T TATCGACC cGT T TAT CCTACATTCCCGT CT ACTTCG T CGTT TATCCTACTTTC C c GTC TACTTC GT CGTTTATCCTACT TTC c cGT C TACTTCG T KANGAROO CTAATC C C cc cGT T TAT C cT ACT T TCCCAT CT ACTAAGT CGT T TATCCTACTT TC C CATGTAGTAA GT GTTTATCCTACTTT CCCATCTACT A A GT АМОЕВА SPONGE CTTATC C C CTAATC c c SHARK LIZARD CTAATC C c |TTAATC DOLPHIN CAT 6. Create a Venn Diagram to show the relatedness of these organisms. Start with the trait that is shared by all the organisms on the outside. Inside each box, write the organisms that…1. Viruses that do not have a lipid envelope tend to remain infectious outside the body longer than enveloped viruses. “Naked” viruses are also less likely to be rendered harmless by soap and water. Why? 2. The apicomplexan that causes malaria has a photosynthetic ancestor and contains an organelle that evolved from its ancestral chloroplast. The organelle no longer functions in photosynthesis, but it does carry out some essential metabolic tasks. Why would targeting this organelle yield an antimalarial drug that would be likely to have minimal side effects?
- 5. Molecular Evidence. Cytochrome c is a protein located in the mitochondria of cells involved with cellular respiration. Compare each organism's Cytochrome CDNA sequences with the ancestor cell and each other. Circle or highlight the differences (mutations) present in the cytochrome CDNA sequences from ancestor cell. ANCESTOR CE A TTAGCGACCAGTATATCC TACA ATC CGT CTACTTCATTO GT CTACT T CAT GTATA CTT CGT CTACT TC GT CTACTTCGT CTACTT CGT CTACT A AGT GT TTAT CCTACTTTCCC ATGTAGTA AGT CTACT A AGT AMOEBA ATTAGCG A A GTTT ATCCT A CA ATC C ATTAT C G AGTTT ATC CT ACATTC C CG T T TAT CCTACATTC C GT T TATC CTACTTT C C SPONGE EARTHWORN CT TAT C G G SHARK CTTATC TTTATC CTACTTTC GTTTATC CTACTTTC C LIZARD CTA AT KANGAROO CT A ATC DOLPHIN CTAATC CAT TTA AT TTTATCC TACT TT C CC A GGAA < 이 이이이 c5. Molecular Evidence. Cytochrome c is a protein located in the mitochondria of cells involved with cellular respiration. Compare each organism's Cytochrome CDNA sequences with the ancestor cell and each other. Circle or highlight the differences (mutations) present in the cytochrome CDNA sequences from ancestor cell. ANCESTOR CELL A T T AG C G A CCAGTATA T C C TAC A A T C C G TCTAC T T CATTO ATTAGCG A CCA GT TT AT C CTACA ATC C C G T CTACTT CAT11 ATTAT c G AC C A GT TT AT CCT ACATT CC c G TATACTTC GT 14 АМОЕВА SPONGE EARTHWORM C T TAT C G A C c c G TT T ATC CTACA TT C C c GT CT A CTT CGT CTTAT Cc ccc CGTTTATCCTACTTTCCCGT CT A CTTCGT CT A AT c cccc c GT T T ATC CTACT TTCCC G T CT A CTT CGT CT A AT c c ccc c G T T T AT C CTA CTT T C C CATCTACTA CTA AT ccc c c c GT T TATCCTACT TT C C CAT GT AGTA TAAT Ccc c c c GT T T AT c CTACT TT C C CATCTACTAAGT SHARK LIZARD KANGAROO GT DOLPHIN GT СAT 6. Create a Venn Diagram to show the relatedness of these organisms. Start with the trait that is…6. Would the following ancestral cell have been a prokaryote or an early eukaryote? Briefly explain your answer. |
- IStructureSE Add-ons Help Last edit was seconds ago Arial 8. BIU A 1 1 2 3 4 6 Match: Read about each organelle. Then match each organelle to its function/description. Capsule A. Hair-like structure that the cell uses for movement. Nucleoid B. Hair-like structure that attaches the cell to a surface and can transfer genetic material from one cell to another. C. Region inside the cell that contains genetic material but is not surrounded by a nuclear membrane. Plasmid Flagellum D. Outermost layer of the cell that provides protection. Pilus E. Circular piece of genetic material. Cempare Wh hecterialcell animal coll212. Below is a diagram of a cell. Which of the following is true? a. The cell is a plant cell, structure 1 is a cell wall and structure 2 is a vacuole b. The cell is an animal cell, structure 1 is a cilia and structure 2 is a vacuole c. The cell is an animal cell, structure 1 is a cilia and structure 2 is a nucleus d. The cell is a plant cell, structure 1 is a cell wall and structure 2 is a nucleus3. The Endosymbiont Theory suggests that some cell organelles may have arisen when a prokaryotic cell was phagocytosed by a primitive eukaryotic cell, but not digested. A symbiotic relationship arose between the two cells, since such cells had a selective advantage, and the cells became extremely successful giving rise to modern eukaryotic cells. Name a structural feature of such organelles that may be a holdover from their origin. What specific organelles might have arisen in this way?