mRNA foster posterior special segments activities defectiveness tRNA all segments addition prevent DNA mutation deletion stabilities One could make transgenic flies that contain a series of deletions spanning of the bicoid mRNA: the coding region and 5' and 3' untranslated regions, and compare s with controls. a degradation-sensitive region or signal sequence is located by that same intact region, when ligated to a noninvolved, nondegraded should bicoid mRNA. If the bicoid mRNA from the of individual, deleted mRNA comparable in both locations. degradation in a manner similar to the end of the egg is placed in the of another egg, one could ask if the degradation process is

mRNA foster posterior special segments activities defectiveness tRNA all segments addition prevent DNA mutation deletion stabilities One could make transgenic flies that contain a series of deletions spanning of the bicoid mRNA: the coding region and 5' and 3' untranslated regions, and compare s with controls. a degradation-sensitive region or signal sequence is located by that same intact region, when ligated to a noninvolved, nondegraded should bicoid mRNA. If the bicoid mRNA from the of individual, deleted mRNA comparable in both locations. degradation in a manner similar to the end of the egg is placed in the of another egg, one could ask if the degradation process is

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter29: Transcription And The Regulation Of Gene Expression

Section: Chapter Questions

Problem 8P: Alternative Splicing Possibilities Suppose exon 17 were deleted from the fast skeletal muscle...

See similar textbooks

Similar questions

A normal mRNA that reads 5’ - UGCCAUGGUAAUAACACAUGAGGCCUGAAC- 3’ has an insertion mutation that changes the sequence to 5' -UGCCAUGGUUAAUAACACAUGAGGCCUGAAC- 3’. Translate the original mRNA and the mutated mRNA, and explain how insertion mutations can have dramatic effects on proteins. (Hint: Be sure to find the initiation site.)
Post-transcriptional Modification of Eukaryotic mRNAs What might be the advantages of capping, methylation, and polyadenylylation of eukaryotic mRNAs?
Alternative Splicing Possibilities Suppose exon 17 were deleted from the fast skeletal muscle troponin T gene (Figure 29.46). How many different mRNAs could now be generated by alternative splicing? Suppose that exon 7 in a wild-type troponin T gene were duplicated. How many different mRNAs might be generated from a transcript of this new gene by alternative splicing?
The method of Northern blotting is used to determine the amountand size of a particular RNA transcribed in a given cell type.Alternative splicing (discussed in Chapter 14) produces mRNAsof different lengths from the same gene. The Northern blot shownhere was obtained using a DNA probe that is complementary tothe mRNA encoded by a particular gene. The mRNA in lanes 1through 4 was isolated from different cell types, and equal amountsof total cellular mRNA were added to each lane. Explain these results.
a. Very few if any eukaryotic genes contain tractswith more than 25 As or Ts in a row, yet almost alleukaryotic mRNAs have a tract with more than100 As in a row. How is this possible?b. Scientists know the nucleotide sequences that directthe termination of bacterial gene transcription, butthey generally have little idea about the nature ofthe nucleotide sequences that direct transcriptiontermination in eukaryotic cells. Explain the basisof this statement.
GTTTTCACTGGCGAGCGTCATCTTCCTACT 8. What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease, etc.) of the protein(s) encoded by the gene.
mRNA sequence of A gene Find 5’ UTR and 3’UTR of mRNA 5’ AAACUGUGACUGAACCUCAAACCCCAAACCAGCCCGAGGAGAACCACAUUCUCCCAGGGA CCCAGGGCGGGCCGUGACCCCUGCGGCGGAGAAGCCUUGGAUAUUUCCACUUCAGAAGCCUACUGGGGAAGGCUGAGGGGUCCCAGCUCCCCACGCUGGCUGCUGUGCAGAUGCUGGACGACAGAGCCAGGAGGGAGGCCGCCAAGAAGGAGAAGGUAGAGCAGAUCCUGGCAGAGUUCCAGCUGCAGGAGGAGGACCUGAAGAAGGUGAUGAGACGGAUGCAGAAGGAGAUGGACCGCGGCCUGAGGUAGAAGCCGCUGGGGCUUGGGGCU-3’
Some exons in the human genome are quite small (lessthan 75 bp long). Identification of such “microexons” isdifficult because these distances are too short to reliablyuse ORF identification or codon bias to determine ifsmall genomic sequences are truly part of an mRNAand a polypeptide. What techniques of “gene finding”can be used to try to assess if a given region of 75 bpconstitutes an exon?
Below is the double stranded DNA sequence of part of a hypothetical yeast genome encoding a very small gene. Transcription starts at nucleotide immediately following the promoter. The termination sequence is TATCTC. How many amino acids will this protein have? 5' TCATGAGATA GCCATGCACTA AGGCATCTGA GTTTATATCT CA 3' 3' AGTACTCTAT CGGTACGTGAT TCCGTAGACT CAAATATAGA GT 5'
Briefly discuss (referring to the images provided) why mutant 2 fails to produce functional protein. Note that none of the mRNA transcribed from this gene is of the expected size; some of the mRNA molecules produced are 223 nucleotides shorter than expected, whilst others are 47 nucleotides longer than expected.
The coding sequences of Gene F and Gene G are shown by the double-stranded DNA below: Gene F 5' ATGGGAGCACCAGGACAAGATGGATATCATTAG 3' 3' AGTTACCCTC GT GG TCCTGTTCTACCTATAGTAS Gene G Questions: 1. Write down the messenger RNA sequence when Gene F is transcribed. 2. Write down the polypeptide chain when Gene F is completely expressed. 3. Write down the messenger RNA sequence when Gene G is transcribed. 4. Write down the polypeptide chain when Gene G is completely expressed.
A single UASG regulates the expression of threegenes, all of which are adjacent: GAL7 and GAL10 asdescribed in Problem 8, and also GAL1.a. Would you expect these genes to be transcribedinto individual transcripts, or to be cotranscribed asone mRNA? Explain.b. How could you determine experimentallywhether each gene is transcribed separately orinstead that the three are cotranscribed into asingle mRNA?c. GAL1 and GAL10 are not only adjacent to eachother, but also are transcribed divergently with asingle UASG between them. Describe experimentsusing GFP and RFP transgenes that would allowyou to determine which of the four GAL4 bindingsites in this UASG element is (are) important for thetranscription of GAL1 and/or GAL10.