Mutation #2: • Change the Mutation to RED TACACC IIGGCGACGACT AUGUGG A ACCG CU G CUGA MET -TRP- ASN - ARG- CYS - (STOP) Original DNA Sequence: MRNA Sequence: Amino Acid Sequence: Mutated TAC GÁC CTT GGC GAC GÁC T DNA MRNA Amino Acid Will this mutation have an effect? What kind of mutation is this? Mutation #3: • Change the Mutation to RED TACACCTTGGC GA CGACT AUGUGG AACCGCU GCUGA MET -TRP- ASN - ARG- CYS - (STOP) Original DNA Sequence: MRNA Sequence: Amino Acid Sequence: Mutated TAC ACC TTA GCG ACG ACT DNA MRNA Amino Acid Will this mutation have an effect? What kind of mutation is

Mutation #2: • Change the Mutation to RED TACACC IIGGCGACGACT AUGUGG A ACCG CU G CUGA MET -TRP- ASN - ARG- CYS - (STOP) Original DNA Sequence: MRNA Sequence: Amino Acid Sequence: Mutated TAC GÁC CTT GGC GAC GÁC T DNA MRNA Amino Acid Will this mutation have an effect? What kind of mutation is this? Mutation #3: • Change the Mutation to RED TACACCTTGGC GA CGACT AUGUGG AACCGCU GCUGA MET -TRP- ASN - ARG- CYS - (STOP) Original DNA Sequence: MRNA Sequence: Amino Acid Sequence: Mutated TAC ACC TTA GCG ACG ACT DNA MRNA Amino Acid Will this mutation have an effect? What kind of mutation is

Name: Mutation #2:• Change the Mutation to REDTACACC TIG GC GACGACTA U GU G
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: Mutation #2:• Change the Mutation to REDTACACC TIG GC GACGACTA U GU G G A A C C G C UG CUGAMET -TRP- ASN - ARG- CYS - (STOP)Original DNA Sequence:MRNA Sequence:Amino Acid Sequence:MutatedTAC GÁC CTT GGC GAC GÁC TDNAmRNAAmino AcidWill thismutationhav

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter29: Transcription And The Regulation Of Gene Expression

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

Name: Date: 2. The sequence of a fragment of one strand of DNA is AATTGCATATACGGGAAATACGACCGG. Transcribe this s sequence into MRNA. er bns eldst eboo oi ebitqeqylog erlt to noihiog eri qu elsm bluow tsri abios onime Jlaw as ye s 1ot noitem atelomet AHG 3. The following MRNA ştrand is being used to asemble a polyp
of estion 9 t of uestion THCA ▶ Sou 100- HC This reaction is Entropy is THC San Leafly ATA RNA polymerase SSSSSSSSSS ATTOGOGACATAA ATGACGGATCAGCCOCAAG UACUOCCUAGUC RNA Transcript TACTOCCTAGTCGGCOTTCOOCTTAACCOCTOTATIT (In this picture, RNA is being made by complementary base pairing with DNA.) This reaction is → Entropy is ◆
Mutated DNA Sequence #2: T A C G A C C T T G G C G A C G A C TWhat’s the mRNA sequence?What will be the amino acid sequence?What kind of mutation is this?Will there likely be effects?
pen+ GEAR Normal DNA Normal RNA Amino Acids Mutant DNA Mutant RNA: Name: FRAMESHIFT MUTATIONS occur when a base is added (or removed) from 8. Determine the amino acid chain coded for by the following sequence. Supp another A is added after the first codon. Complete the chart showing the amir normal and mutant sequence. Amino Acids Investigation: DNA. Proteins. and Mutatic TGG AGT CGA GGT TGG AAG TCG AGG T Why are frameshift mutations likely to cause more problems than a p 9. Cystic fibrosis is a disease that causes mucus to build up in th misshapen protein in the cell membrane which interferes with the popociated with the disorder
48 Second letter If any single nucleotide is deleted from the DNA sequence shown below, what type of mutation is this? UUU U UUC UUA UCU Phe UCC UAU UGU Cys ANTISENSE 5' GGACCCTAT3' UAC Tyr UGC UAA Stop UGA Stop UAG Stop UGG Trp Ser UCA Leu UUGL" UCG CUU CU CAU) His CAC) CGU CGC CGA Arg CUC C Leu Pro CAA1 Gin CAG) CUA CCA CUG CG CGG AAU AAC Asn AGC AAA AAG Lys AGG Arg AUU ACU AGU Ser AUC lle ACC Thr AUA ACA AGA AUG Met ACG GCU GCC GUU GAU] GGU GUC Val GAC Asp GGC Ala Gly GUA GCA GAA GGA Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a FRAMESHIFT SILENT NONSENSE MISSENSE Third letter First letter
3’-T A C G G A C T G A C G A T C-5’ What is its Complementary DNA sequence? mRNA sequence transcribed from template?Amino acid sequence of peptide?and Type of mutation?
Mutated DNA Sequence #1 TACAT C TTG C G A C GAC T... What's the mRNA sequence? (Circle the change) amino acid sequence? Will there likely be effects? What type of mutation is this?
pcc300ATAAADATATAOOTTAA 1. Use the genetic code table and the information in the diagram below to determine the amino acids that would make up the portion of the polypeptide shown. Include information for a key as well. DNA template 3' G CATA ACAGAGGATT-5' al bnsua AMAm pniwollot erfT E transcription s yd bnsita ebitgeqylog s sidmeaze of beae RNA strandUU UAOUOUU A-emoaodin 5'-CGUA AUUGUC UCCUUA- 3' J J JL erit o elinW (s) translation bluow terdt aspnso sigootiwsone polypeptide viemetis ns ebivo19 (d) ent ot etslanT Key:
Mutated DNA Sequence #2: T A C G A C C T T G G C G A C G A C T What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What kind of mutation is this?
AGUCAGUCAG The codon chart is shown below, what amino acid sequence does the MRNA sequence: 3' UUUCCUCAA 5' code for? RNA Codon Chart 31 Alanine G U A Tyrosine Stop Valine A G Cysteine U 3' U G Stop G Tryptophan 3' G 5' Arginine G U A Leucine Serine A Lysine A U Proline G Asparagine leucine-threonine-glutamic acid asparagine-serine-phenylalanine serine-histidine-glutamine phenylalanine-proline-histidine phenylalanine-proline-glutamine Serine Glutamic acid Aspartic acid Histidine Glutamine Arginine Isoleucine 2 Threonine Methionine Q
Mutation #3 DNA template: 3' TA CGCGCTGCACGATGCAGTAGTACATC 5' mRNA transcript sequence: Amino acid sequence: Type of mutation: Mutation #4 DNA template: 3' TACGCGTGCACGATGCAGTAATACATC5' mRNA transcript sequence: Amino acid sequence: Type of mutation:
Why do you think this substituion is named " NonSense". In your response explain what it means to have a stop codon. Use evidence from the diagram. Ready? Enter your answer here.