Q: Mendel's laws of segregation and independent assortment are based on the movement of chromosomes…
A: Mendel conducted the experiments on the garden peas. He chose some unique traits of peas and…
Q: What group does the pear tree belong to?
A: a yellowish or brownish-green edible fruit with sweet, slightly gritty flesh that is normally thin…
Q: what makes a bird's reflexes so much faster than a human's? explain some superior aspects of a…
A: Reflexes play an important role in protecting the animal or bird as they act as defense mechanisms…
Q: (c) Tabulate the comparison of the hazard effects from the presence of Clostridium perfingens and…
A: Microbiology is the science of microbes. Microorganisms aid in the creation of various foods,…
Q: make a gram-positive pyogenic cocci differentiation flow chart with full explanation on each step
A: Gram-positive anaerobic cocci (GPAC) are a diverse group of organisms that are distinguished by…
Q: Distinguishing features of: 1. Schistosoma japonicum 2. Taenia solium 3. Trichuris trichiura
A: Parasites include,various protozoa and worms which may infect humans, causing parasitic diseases. A…
Q: Baltimore classification Characteristics (dsDNA, ssDNA, dsRNA, ssRNA (-),ssRNA (+), ssRNA RT, ds DNA…
A: Baltimore classification is based on the viral genome, whether it is made of DNA or RNA, whether the…
Q: sequence of amino acids.
A: The central dogma of molecular biology is the concept which explains the flow of genetic…
Q: In a shocking discovery, biologists discover dragons! Dragon geneticists determine that flame eyes…
A: Introduction: True Breeding Flame Eyed Burbling Female = FFBB True Breeding Blue Eyed Whisting…
Q: The lack of a cure or effective treatment for malaria can be attributed to... Group of answer…
A: Introduction Plasmodium falciparum belongs to the protozoa. It is unicellular protozoa that cause…
Q: BSC1010C Enzymes & Cellular Regulation Dr. Harris 17. Describe the relationship between enzyme…
A: Enzymes are biocatalysts which convert substrates into products. The enzyme activity is defined as…
Q: Explain the use of Biotechnology ?
A: Introduction: Biotechnology is the application of biology to the problem-solving and product-making…
Q: As you learned in this chapter,restriction enzymes are sophisticated“scissors” that geneticistsand…
A: Making many, exact copies of a specific segment of DNA is known as DNA cloning. The gene or other…
Q: List the advantages and disadvantages of using plasmids as cloningvectors. What advantages do BACs…
A: YACs (years artificial chromosomes) are frequently used to replicate DNA in yeast and include…
Q: Owen below Dome Statement about fish post Poisoning in which Statement Encerning dcomborid fish…
A: Answer :- The option 3 is incorrect because symptoms are usually occurs within 1-24 hours. Scombroid…
Q: Compare and contrast sexual reproduction vs. asexual reproduction.
A: Answer :-
Q: In emphysema, there is: 1) fewer "walls" (or septa) between alveoli 2) many, smaller alveoli (3)…
A: Emphysema It refers to a chronic lung disease. This disease develops after many years of smoking.…
Q: Is hepatitis A, enveloped or non-enveloped and what’s it’s shape, genetics / host type/range??
A:
Q: Describe REM and non-REM sleep.
A: Introduction: Sleep is Natural transient condition of rest during which a person loses their ability…
Q: Explain the example of predominant method for sequencing genomes ?
A: The study of genomes' design, functioning, development, sequencing, and modification is the emphasis…
Q: Q2. Analogy. Select the missing animal pair or common trait or type of evolution. Paired Animal…
A: Answer :-
Q: "DNA Sequence Analysis Relies on Bioinformatics Applications and Genome Databases". Explain this ?
A: DNA sequence analysis is a vital tool in modern biology, allowing us to understand the function and…
Q: Describe the two methods a bacterial cell dies due to activating the complement system;
A: The complement system is an innate immune system component that consists of a series of proteins…
Q: Use the pedigrees below to answer the corresponding. What is the most likely mode of inheritance for…
A: Introduction : A chart which displays the affected members of a family by genetic diseases in the…
Q: Normally, your immune system recognizes the MCHI on the outside of your cells as self. This is…
A: MHC is a major histocompatibility complex. This locus codes for cell surface proteins that play a…
Q: he application of genetic engineering.
A: Researchers can transfer desired genes from one plant or animal to another via genetic engineering.…
Q: What are all possible factors that affect urine flow rate
A: Organs in the human excretory system make it easier to remove nitrogenous wastes from the body. The…
Q: Is protein synthesis necessary for short-term synaptic plasticity, long-term synaptic plasticity, or…
A: INTRODUCTION Synaptic plasticity This is the modifications in strength of synaptic transmission that…
Q: why single-nucleotide polymorphisms (SNPs) are important ?
A: DNA is a double standard molecule made up of nucleotides. Each nucleotide is made up of deoxyribose…
Q: What kind of tissues are pointed in the following tissue samples? Explain you answer. * A B C
A: A group of cells that are arranged in a particular pattern and perform the same function constitutes…
Q: Which are Body Fluid Compartments?
A: Human body weight is mostly composed of water, which ranges from around 75 percent in babies to…
Q: Below are 9 possible primer pairs. ● Determine which primer pair is the best choice. ● Explain why…
A: Primers are used in the PCR or polymerase chain reaction. These primers anneal at a particular…
Q: What is the major difference between the dyssomnias and parasomnias?
A: Introduction: Although a vast range of illnesses and symptoms are covered by the phrase "sleep…
Q: What cellular signaling molecule (mediator) is released to activate B lymphocytes at stage 2". ●…
A: B lymphocytes are the cells of immune system which will fight with pathogens via the formation of…
Q: What is it called when one organism moves from another environment?
A: Environment It refers to the surrounding or conditions in which an organism lives. It is complex of…
Q: 1. This picture below shows the external structures of the stem, how old do you think is this twig?…
A: Introduction A twig is a very tiny, delicate branch that emerges from a tree or bush's main branch.
Q: In the 1970s, scientists realized that there might be unforeseendangers and ethical issues with the…
A: None men are islands. This adage applies to ecological creatures as well. No living thing survives…
Q: What kinds of cells does meiosis produce? exact copies unique
A: Cell is the structural and functional unit of life. It undergoes division to form new cells. It is…
Q: Fucose Ceramide Anti-A antibody Sphingosine Galactose H antigen Universal Donor Agglutination Rhesus…
A: Humans have different blood groups and blood groups are characterized by the presence of different…
Q: Which are Body Fluid Compartments?
A: The body fluid is the fluid present in the body. The normal human body consists of 50 -60% of water…
Q: Discuss the structures of the following organisms when viewed under the microscope: Scolex of…
A: Tapeworm Belongs to the class of eucestoda of platyhelminthes . They all are endoparasites. They…
Q: In an effort to identify the influence of genetic factors on both Type 1 diabetes and Type II…
A: Diabetes:a condition where the body's ability to produce or respond to the hormone insulin is…
Q: State whether the animal is internally segmented, externally segmented, or both. 1. Fish 2.…
A: Introduction Segmentation divide the body of animals into repetative segments. For example phylum…
Q: Two animals of the same______ are able to breed to produce fertile offspring. A.Class B• Genus ©…
A: The relative position of an organism group (a taxon) within a taxonomic hierarchy is known as…
Q: Choose the incorrect statement for vernalisation D O Qualitatively and quantitatively dependent on…
A: Russian scientist Lysenko discovered in 1928 that plants or moist seeds can be treated at low…
Q: How SNPs can be detected and used for diagnosis and treatmentof disease ?
A: The study of genomes' architecture, functioning, development, sequencing, and modification is the…
Q: Give Some examples of “omics” ?
A: Since the mapping and sequencing of the human genome got underway, new advances in technology have…
Q: What are Connective-Tissue Cells?
A: Connective tissues are specific tissues. They support other body tissues. These tissues are made up…
Q: Question- How is genetic drift different from natural selection? choose one from below 1. Natural…
A: Introduction: According to the principle of natural selection, organisms breed more young than they…
Q: 會 先 t
A: As a cell grows and develops it undergoes series of events collectively called cell cycle . This…
No Genome Left Behind and the Genome 10K Plan. Explain about this ?
Step by step
Solved in 2 steps
- Genome for C. diphtheriae have about 2,500,000 nucleotides, 87% of them are coding. This ingle circular chromosome contains 2,389 genes from which 2,272 proteins are coded. It does not contain any plasmids. The genome contains Pathogenicity Islands (PAIs), which C. diphtheriae has 13. What is a PAI and what are their characteristics?Can you help with 1a please HELPFUL INFORMATION: When performing classical Sanger or "dideoxy" sequencing, you set up 4 parallel reactions per template to be sequenced from a specific primer, with each of the four reactions containing a different dideoxynucleotide, and then the four reactions were run in a separate, adjacent lanes on a gel. 1a. Why couldn't you combine all 4 dideoxynucleotides with the primer and the template and do the whole reaction in one tube, and then run the set of fragments produced by the reaction mixture on a single lane in an acrylamide gel?The structure of a typical pUC19/human DNA recombinant clone. Ensure that you clearly indicate the restriction enzyme sites at the ends of the human DNA insert. Hint: think about the compatibility of the ends generated by partial digestion of human DNA and complete digestion of the vector – will the original sites in the vector be regenerated or not, or it is impossible to predict?
- Concept 23. A gene is a discrete sequence of DNA nucleotides. This concept describes the discovery of the DNA sequencing technique that made modern biology and bioinformatics possible. The method was later used to sequence the human genome and genomes of many other organisms. This led to the accumulation of great numbers of nucleotide and protein sequences in the numerous databases. The concept 23 web page is here: http://www.dnaftb.org/23/ After reading the Concept page, answer the following questions. What was the Mendel’s definition of a gene? How was it different from the definition by Beadle and Tatum? Describe proteins based on the early sequencing efforts. What was the definition of a protein coding gene based on the genetic code? What are the beginning and ending codons of the gene’s protein coding sequence? What is the name of the method that makes use of a “defective” DNA nucleotide? After reviewing the Animation pages, answer the following…BamHI cut sequence: G//GATCC and each sequence is 250 nucleotides long. How many DNA segments would be created by cutting the normal gene with BamHI?Describe your amplicon based on molecular size. Comparing the size of the genomic DNA Describe your amplicon based on molecular size. Comparing the size of the genomic DNA (as seen in Fig. 8.1) and the PCR products based on band position in the gel (as seen in Fig. 8.2).
- In the following gel showing stained bands of the Alu insertion sequence, what is the genotype of individual 2? 941 bp 641 bp->>> 1 2 3 4 5 6 Homozygous for the 641 bp sequence that does not contain in the Alu insertion Heterozygous, containing one 941 bp sequence and one 641 bp sequence O Homozygous for the 941 bp sequence containing the Alu insertionCynt Classifying mutations A certain section of the coding (sense) strand of some DNA looks like this: $-ATGTATATCTCCAGTTAG-3" It's known that a very small gene is contained in this section. Classify each of the possible mutations of this DNA shown in the table below. mutant DNA 5- ATGTATCATCTCCAGTTAG-3' S-ATGTATATCTCCAGTTAG-3 5- ATGTATATATCCAGTTAG-3' type of mutation (check all that apply) insertion deletion point silent noisy insertion O deletion point silent noisy insertion O deletion point silent Onoisy X GHuman Genome ProjectIn 2003, the Human Genome Project was successfully completed, determining the exact sequence of the entire human genome, which is made up of 3 billion nucleotide base pairs. The data generated from the Human Genome Project is freely available online to anyone. Many pieces of research and innovations stemmed from the HGP, allowing the identifications of 1 800 disease genes. Many of the corporations using the results from the HGP are privately funded, and research is being done for profit even though the HGP results are provided freely. Identify one advantage and one disadvantage of corporate funding and patenting genetic research results.
- Human Genome ProjectIn 2003, the Human Genome Project was successfully completed, determining the exact sequence of the entire human genome, which is made up of 3 billion nucleotide base pairs. The data generated from the Human Genome Project is freely available online to anyone. Many researches and innovations stemmed from the HGP, allowing the identifications of 1 800 disease genes. Many of the corporations using the results from the HGP are privately funded, and research is being done for profit even though the HGP results are provided freely.Identify one advantage and one disadvantage of corporate funding and patenting genetic research results.e. four-base, not overlapping4. An example of a portion of the T4 rIIB gene in whichCrick and Brenner had recombined one + and one −mutation is shown here. (The RNA-like strand of theDNA is shown.)wild type 5′ AAA AGT CCA TCA CTT AAT GCC 3′mutant 5′ AAA GTC CAT CAC TTA ATG GCC 3′a. Where are the + and − mutations in the mutant DNA?b. The double mutant produces wild-type plaques.What alterations in amino acids occurred in thisdouble mutant?c. How can you explain the fact that amino acids aredifferent in the double mutant than in the wild-typesequence, yet the phage has a wild-type phenotype?Primer designing: A single-stranded DNA sequence (963 nucleotides) that codes for a hypothetical protein are shown below (lower case shaded blue). 1. Design a pair of forward and reverse primers (~18 nucleotides long each) with EcoRI and BamHI added at 5' and 3' ends, respectively, for the amplification and cloning of this a plasmid with the same restriction sites. gene into GTATCGATAAGCTTGATATCGAATTCatggctaaaggcggagct cccgggttca aagtcgcaat acttggcgct gccggtggcattggccagccccttgcgatgttgatgaagatgaatcctctggtttctgttctacatctatatgatgtagtcaatgcccctggtgtcaccgctgatatta gccacatggacacgggtgctgtggtgcgtggattcttggggcagcagcagctggaggctgcgcttactggcatggatcttattatagtccctgcaggtgttcctcg aaaaccaggaatgacgagggatgatctgttcaaaataaacgcaggaattgtcaagactctgtgtgaagggattgcaaagtgttgtccaagagccattgtcaacctg atcagtaatcctgtgaactccaccgtgcccatcgcagctgaagttttcaagaaggctggaacttatgatccaaagcgacttctgggagttacaatgctcgacgtagt cagagccaatacctttgtggcagaagtattgggtcttgatcctcgggatgttgatgttccagttgttggcggtcatgetggtgtaaccatttgccccttctatctcagg…