O Steps of Translation 1. 2. The ribosome looks for leaves the nucleus and binds to a Codon: group of specifies one amino acid. (transfer RNA) 3. 4. This tRNA has an nucleotides on the messenger RNA that carries amino acids to the mRNA. that matches the codon on the mRNA strand. group of 3 unpaired nucleotides on a tRNA strand. is dropped off and a chain forms. When the 5. Each chain is completed, it disconnects and makes a Translation Practice: What amino acids do these codons stand for? 1. AUG- 2. GGA- 3. GAG- 4. CAA- 5. What amino acid does the anticodon CGU stand for? 6. Find the amino acid sequence for the following mRNA sequence (translation): AUG CGA CGAA U U U AA
Q: Refer to the diagram to answer this question. Blood vess hormone An organ with endocrine function is…
A: Location and Structure:The pancreas is an organ located behind the stomach in the abdomen.It has a…
Q: Your crazy uncle is waging a culture war at the holidays again! This time he's talking about how sex…
A: Sexual development in humans is a complex process that is regulated by a variety of factors,…
Q: During exercise your pCO2 levels rise to 50 mm Hg while your pO2 levels drop to 80 mm Hg. Your…
A: Peripheral chemoreceptors are specialized cells that detect changes in the chemical composition of…
Q: If a patient has gotten into a fight and comes into the ER with a fracture to his or her cheekbone,…
A: When a patient presents at the Emergency Room (ER) with a cheekbone fracture, doctors conduct a…
Q: The process by which the most favorable or optimal conditions are maintained in the body is…
A: Homeostasis is the physiological process that maintains the stability of internal conditions within…
Q: Waht is skeleton system? Do it
A: The skeletal system, or skeleton, is the framework of bones that supports and protects the body,…
Q: Image #2 arm ribs
A: The diagram represents the peripheral nerves of the human body. Peripheral nerves originate from the…
Q: Blood pressure in the glomerular capillaries is lower than in other capilary beds responsible for…
A: The glomerular capillaries are a network of tiny blood vessels in the kidneys, specifically within…
Q: Recent research suggests that obsessive-compulsive anxiety disorder may be related to…
A: Obsessive-compulsive disorder (OCD) is a mental health condition characterized by intrusive,…
Q: HISTORY: A 5-year-old boy who presented in infancy with cyanosis and dyspnea, later worsened with…
A: 1 . Review the History and Physical Examination :Note the presence of cyanosis and dyspnea in…
Q: 19 20 21 3 4 2 5 10 11 1 12 MAR MUN w Anatomy and Physiology Lab Manual Collagen fibers shal 6 8 9…
A: Cells are the basic structural and functional units of living organisms. They are the smallest…
Q: The You are a health professional! A patient has come to your office with an odd-looking mole. You…
A: Region of the Body:Identify the broader region where the mole is located. For example, you might say…
Q: Describe six disorders that affect the skeleton and joints.
A: The human skeletal system, comprising bones and joints, forms the structural framework of our body.…
Q: Identify and define some of the prefixes used in medical terminology.
A: Medical terminologies are the terms used by healthcare professionals during the study of medical…
Q: What is the P Wave in the strip? Sinus Intermittently present Multiform Irregular the
A: Option A - Sinus is correctThe P wave is the first positive deflection on the ECG.It represents…
Q: What two neurotransmitters/hormones do beta-3 receptors respond to?
A: Beta-3 receptors are a type of adrenergic receptor, which are protein molecules located on the…
Q: CARDIOVASCULAR SYSTEM REVIEW OF PRINCIPAL ARTERIES CN: The arteries are shown bilaterally in the…
A: ARTERIES OF THE UPPER LIMB:A. Subclavian artery: Supplies blood to the upper limb, shoulder, and…
Q: a) Match the regions (Red, Green, Blue) with the functiontions. A. Contraction of the atria B.…
A: An ECG, which stands for electrocardiogram, is a diagnostic tool that records the electrical…
Q: PLACE THE FOLLOWING IN THE RIGHT ORDER STARTING AT THE RENAL ARTERY place your cursor on the dots to…
A: The kidneys are vital organs that perform many functions to keep the blood clean and chemically…
Q: How does the eye transduce light energy into a neural message? What is the blind spot in the eye and…
A: The process of transducing light energy into a neural message occurs in the retina, the…
Q: After a period of time without oxygen, the myocardium will undergo necrosis, a condition of….of the…
A: When the myocardium, which is the muscle tissue of the heart, is deprived of oxygen for an extended…
Q: neurotransmitter
A: Glutamate is a neurotransmitter in the brain that plays a crucial role in various neurological…
Q: When performing contract relax (CR) stretching, how many times can the sequences be repeated?
A: Contract-Relax (CR) stretching is a widely employed technique in flexibility training that involves…
Q: Which of the following is incorrect regarding parturition: A B C D it is a classical example of…
A: Parturition refers to the process of childbirth, from the start of uterine contractions to the…
Q: The most important buffer in our blood plasma is protein phosphate bicarbonate/carbonic acid system…
A: Buffers in blood plasma are chemical systems that play a crucial role in maintaining a stable pH…
Q: Explain what combining forms are and why they are used.
A: Medical terminology or medical terms are important words used during the study of medical subjects.…
Q: RARY SCIENCEphoto
A: The above figure is illustration of the pituitary gland. The pituitary gland is an endocrine gland…
Q: 5. Use the anatomical terminology to compare the locations. A is Fis Bis Dis Cis E is to E. to A. to…
A: Anatomical terms are the terms used to determine the specific body structure, parts, location as…
Q: Which are most closely regulated by the body? motility and secretion absorption and motility…
A: The intricate workings of the digestive system involve a delicate interplay of various processes,…
Q: What causes the spike of luteinizing hormone so ovulation can begin?
A: The spike in luteinizing hormone (LH) that triggers ovulation is known as the LH surge. The LH surge…
Q: Red blood cells Multiple Choice are columnar in shape. have several nuclei in each cell. divide…
A: Erythrocytes, another name for red blood cells (RBCs), are vital to the circulatory system because…
Q: What actually happens in the fluid compartments of your body when you are either extremely…
A: Body fluids are liquids originating from inside the bodies of living humans. They include fluids…
Q: The structures involved in normal expiration. (What is primarily involved in normal expiration, and…
A: Respiratory system is a type of body system which involves entry of oxygen inside the body and…
Q: #3 Name and give the functions of the four basic types of tissues in the body.
A: The simplest form of structural organization begins with an atom. Atoms group together to make…
Q: Circle the letter of each activity that is controlled by the somatic nervous system. a. Beating of…
A: The nervous system is divided into two main parts: the central nervous system (CNS) and the…
Q: Describe the female monthly cycle. What happens in the ovary and uterus at the different stages of…
A: The female monthly cycle, also known as the menstrual cycle, is a complex series of events that…
Q: 1. Describe the function of bones
A: Since you have posted multiple questions, we will provide the solution only for the first question…
Q: Label: Vesicles Neurotransmitter Synaptic cleft Pre-synaptic neuron Target cell neurotransmitter…
A: A synapse is a structure that permits a neuron to pass an electrical or chemical signal to another…
Q: Instructions This is a ‘scenario problem’. Read the information and answer the questions. Your…
A: The objective of the first question is to determine the optimal speed of travel for the treasure…
Q: 9. male A 62-year-old Caucasian presents to the emergency room chest with severe substernal pain,…
A: The objective of the question is to identify the artery that is most likely occluded, causing a…
Q: How are systolic and diastolic pressure determined using Korotkoff sounds?
A: The objective of this question is to understand how systolic and diastolic blood pressures are…
Q: potentiation
A: The hippocampus is a crucial region within the brain, playing a pivotal role in the formation of…
Q: What is the corpus luteum? Assuming the ovum remains unfertilized, what is the lifespan of the…
A: The female reproductive system is designed to carry out several functions. It produces the female…
Q: Describe the process that makes us want to drink water. What are the triggers and the responses?
A: Thirst is the desire to drink water or other liquids. The human body is made up of about 60-70% of…
Q: How are systolic and diastolic pressure determined using Korotkoff sounds?
A: Blood pressure (BP) is checked using a sphygmomanometer and stethoscope. It is part of most routine…
Q: Select all of the following involved in the fight or flight response: (Multiple select question) A.…
A: Fight or flight response is the body's response to a danger or stressful situation. When a person is…
Q: Put each of the following into the category it belongs with respect to the menstrual cycle. Time…
A: The proliferative phase occurs in the first half of the menstrual cycle. It spans from days 6 to 13,…
Q: Match the following: Cranial nerve to its function. Answers may be use more than once. Hypoglossal…
A: The nerves are a medium to transport electrical impulses from the brain to different parts of the…
Q: The Endocrine System can be complex to learn; map out one of the "chains" of three hormones that you…
A: The objective of the question is to explain the chain of hormone release in the endocrine system,…
Q: 2. Fill in the blanks in the table below Cell Radius (R) Surface Area (? ?) Volume (?) Surface Area…
A: Surface Area=4πr2 Volume=34πr3For the first cell (10μm): Surface Area10=4π(10)2…
Hello I need help with the blanks.
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- Part 3: Three Types of RNA THREE one amino acids ribosome gene * There are types of RNA. Complete the table below with the function of each type. Type of RNA Function Picture Carries the genetic code for MRNA (messenger) copied from the DNA. Messenger RNA Brings the to TRNA (transfer) the ribosome during protein synthesis. Transfor RNA Makes up the structure of the FRNA the organelle (ribosomal) responsible for making the proteins. Ribosomal RNATranscription and Translation For the following strand of DNA, show me the messenger RNA strand and the transfer RNA strands. I have only drawn the coding strand of DNA. DNA: I LATACCGAATTIACGC CCCAA ATTCTIGAGC CATDNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ From the given DNA sequence above, change one base in codon 8 to show same sense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 8 Add an A before codon 3 or delete the middle base in codon 3 to show the shift of reading frame to:a. the rightDNA:mRNA:polypeptide chain:b. the leftDNA:mRNA:polypeptide chain:
- language nitrogen bases Part 5: Translation - the 2nd step in protein sunthesis language (A UO) MRNA * Once the MRNA gets to the ribosome, it tries to tell the ribosome the message, but it doesn't understand. Cells can't "read" nucleic acids. translation tRNA * A translator called is needed to decode the message and make a protein! protein amino acids protein aming acids translation protein hucleic acids * MRNA is a genetic messenger which caries infortmation in the ORDER of its protein The order of the nucleotides determines the order of the - AMINO ACIDS linked together create a o In this information (the order of MRNA's nucleotides) will be used to detemine the order of and therefore create a * Translators turn one into anotherX Protein production takes place in the cytoplasm. in the nucleolus. outside the cell. in the Golgi apparatus. in the nucleus.10. A portion of 5'-AUGCCACGAGUUGAC-3'. What amino acid sequence does this code for? To answer the question please: I) explain what is the genetic code and list the properties of the genetic e 2) draw a diagram of protein synthesis; 3) determine which tRNA should be attached to the mRNA; 4) what is the anticodon for the very first tRNA that will attach to mRNA? mRNA molecule has the sequence an
- Name (Last, First): DNA An RNA polymerase attaches to the DNA and transcribes the DNA to mRNA Ribosone BIO 340 Activity # 1: DNA and the Central Dogma Complete: DNA Coding 5' ATG TGG ATT CTC AAG ATC AAT AGT 3' DNA template 3 5' Cytoplasm Nuckus Nuclear pore ARNA Use the mRNA codon sequence and the genelic Landelable in order to find the amino acid (AA) sequence of the protein. Example: if mRNA sequence is GUU then the corresponding amino acid 3-letter is Valine (Val) and the corresponding amino acid 1-letter is V. mRNA codon 5' FIRST (5') LETTER tRNA codon 3 U AA 3-letter AA 1-letter Amino acid AA - Amino acid A tRNA THE GENETIC CODE New protein being built U Pie (F) ասա UUC) ԼԱՔ Uva) Lou (L) Leu (L) val (M) Use numbers 1 to 3 to indicate the correct order of the flow of biological information. Translation Replication Transcription Hydroxyl group Deoxyribose sugar DNA's charge is negative due to following (circle the correct one): An alpha helix and a beta sheet in a protein are a type…Codon chart: We interpret mRNA 3 base pairs at a time. This is known as a codon. A codon table can be used to translate a genetic code into an amino acid sequence. The full set of relationships between codons and amino acids (or stop signals) is called the genetic code. The genetic code is often summarized in a table like the one below. Second letter A G UUU UUC J UGU Cys UCU) UCC UCA UCGJ UAU U Phe Tyr UACS UGCJ Ser UAA Stop UGA Stop A UAG Stop UGG Trp UUA UUG FLeu G CUU ) CỤC CUA CUG CCU ) ССС ССА CCG CGU CGC Arg CAU) CÁC His САА Leu Pro CGA Gin CAG CGG AUU AAU ACU АСC ACA Asn AGU Ser AAC JAsh AGC. AUC le A AUA AGA Arg Thr AAA AAG. }Lys A AUG Met ACG AGG J G GUU GUC G Val GUA GUG GCU) GCC GCA GCG GAU1 GACS GAA) GAG Glu GGU GGC Gly U C A Ala GGA GGG] G First letter UUAG Third letterlanguage nitrogen bases Part 5: Translation - the 2nd step in protein sunthesis language (A. U, C, G) * Once the MRNA gets to the ribosome, it tries to tell the ribosome the message, but it doesn't understand. Cells can't "read" nucleic acids. translation * A translator called tRNA is needed fo decode the message and make a protein! protein amino acids MRNA protein amino acids translation protein nucleic acids protein * MRNA is a genetic messenger which carries information in the ORDER of its AMINO The order of the nucleotides determines the order of the ACIDS linked together create a O In this information (the order of MRNA's nucleotides) will be and therefore create a used to determine the order of into another * Translators turn one into a * So... in BIOLOGY we are translating
- Protein Synthesis Worksheet Key DNA 1. 2. G C U MRNA 3. TRNA Amino Acids 4. (Methionine 5. MRNA is synthesized in translation or transcription? 6. MRNA has codons or anti-codons? DNA 7. 8. C MRNA U A tRNA 9. C Amino A cids 10. Leucine -0- -00- -0- -0- -0- -0- -0-Preview attachmen.. 63 62 GI GGU G5 G 4 W AUG GCC AUG CUC CUC UUC GAG ACG UAC CGG R (thế strand) [+] CUC GAG AAG The circled portion labeled Y is known as a(n): O ribosome O DNA molecule O codon O tRNA molecule O anticodon the « Previous Next > & 5 6 7 8. uAKS 5c1: Which explanation accurately describes the model below? * DNA MRNA Transcription Mature MRNA Nucleus Transport to cytoplasm for protein synthesis (ranstation MANA Cell membrane This model represents protein synthesis since the tRNA is delivering amino acids to form a polypeptide chain that will form a protein. This model represents protein synthesis since the tRNA is delivering lipids which will be used to bond proteins to form an enzyme. This model represents protein synthesis because DNA is being copied during transcription in the nucleus before leaving the nucleus. This model represents protein synthesis because MRNA is coiling to form a new protein molecule in the cytoplasm.