Of those in the following list, which organ(s)/tissue(s) is/are affected by mutations in this gene CAGATTGTGAAGAGGTCTCTTGA? select all that apply a. pancreas b. skin c. heart d. eyes e. spine and skeleton f. colon
Q: Describe the role of each of the membrane proteins shown in the picture below. Think about what is…
A: The NADH and FADH2 formed during the glycolysis and TCA cycle transfer electrons to the oxygen. The…
Q: Which statement about glutamine amidotransferases is FALSE?
A: Glutamine amidotransferases is an enzyme which catalyzes the removal of ammonia group from glutamine…
Q: What charge at pencentage of the Histidane side chain will PH = 7₁4? Cerrry No.
A: His is basic polar amino acids and His contains imidazole as side chain group. pKa of His is 6. pH…
Q: Meselson-Stahl Experiment showed that DNA replication is semi-conservative. In the experiment, DNA…
A: DNA replication is the biological process by which two identical replicas of DNA from one original…
Q: (c) Outline how you would investigate whether BCMAP would be an effective inhibitor for the protein…
A: Inhibitors are the molecules that slow down or completely block the protein activity of molecules,…
Q: Which steps in eukaryotic translation require the cleavage of a phosphodiester bond from GTP? Choose…
A: Eukaryotic translation is the process by which eukaryotes synthesize polypeptide chains with respect…
Q: The following amino acids that are often found inside globulin molecules are () A, Tyr B, Phe C, Asn…
A: Proteins are polymers of amino acid residues linked via peptide bonds. Amino acids are biomolecules…
Q: How many mL of 10 x stock solution would you need to make 118 mL of 1x PBS? Report your answer to 1…
A: The equation of dilution: C1 x V1 = C2 x V2 Where, C1 is the concentration of the stock solution. C2…
Q: Which energy system did you use for a vertical one-clap pushup or pushup? (Choose one) A) ATP-PC…
A: Answer ATP-PC system Explanation The ATP-PC system, also known as the phosphagen system, is the…
Q: Give 10 examples of enzymes that use NAD/ NADH and NADP/ NADPH and their functions.
A: NAD/NADH and NADP/NADPH act as intermediates in several biochemical reactions. NAD+/NADH and…
Q: In protein structure, which is not established via secondary interactions? o tertiary o secondary o…
A: Proteins are polymers of amino acids linked by peptide/amide bond with release of one water molecule…
Q: Cow's milk allergy (CMA) and lactose intolerance both result from dietary exposure to cow's milk and…
A: “Since you have posted multiple questions, we will provide the solution only to the first question…
Q: QUESTION 03 - Regarding the amino acid arginine, answer the following questions: (Data: pka NH₂ Lyd…
A: Amino acids are biomolecules that have an amino group, a carboxyl group and a side group linked to…
Q: Draw the L(leucine)-A(alanine)-E(glutamate) triple tide and calculate its isoelectric point.
A: Amino acid sequences are written with N-terminal amino acid on the left and C-terminal amino acid on…
Q: why is enzyme efficiency represented by kcat/Km rather than Vmax
A: Enzyme kinetics is the study of the rates of chemical processes that are catalysed by enzymes. The…
Q: Which of the following statements is/are CORRECT? A) Phosphoenolpyruvate carboxykinase is inhibited…
A: Gluconeogenesis is the metabolic pathway in which Glucose is synthesized from non carbohydrate…
Q: 1) What is ATP, and why is it significant in metabolism? 2) What is the relationship between NAD and…
A: "Since you have asked multiple questions, we will solve the first three questions for you. If you…
Q: Which of the following has the lowest probability of cardiac event-free survival? high CRP and…
A: Introduction LDL (low-density lipoprotein) is also known as bad cholesterol. It can cause blockage…
Q: Citric Acid Cycle Notes? C² 1000 K
A: In aerobic condition, pyruvate in the presence of pyruvate dehydrogenase complex produces Acetyl…
Q: Rationalize the use of all the reagents used in Agarose gel electrophoresis.
A: Agarose gel electrophoresis is a technique used to separate nucleic acids based on the size. The…
Q: 1 what is the net reaction of the citric acid cycle? what happens to each product? 2 Starting with…
A: Citric acid cycle (or TCA cycle or tricarboxylic acid cycle) is the final common oxidative pathway…
Q: 1) Define the following terms as they relate to protein synthesis (translation). A) initiation B)…
A: Since you have posted multiple questions, we will provide the solution only to the first question as…
Q: Hd 12 10 8 6 4 2 0 not text. 0.5 only, no text. only, no text. 1 1.5 NaOH Equivalents 2 You create…
A: Amino acids are biomolecules k that have an amino group, a carboxyl group and a side group linked to…
Q: ✓ Part B What further experiment should be carried out in order to determine the primary structure…
A: Introduction Protein is the most abundant macromolecule in our body. Amino acids are the building…
Q: Bond Type: Description: ОН CH2OH ОН ОН ОН Н ОН От CH₂OH ОН Н OH-0 ОН Н ОН :CI: Nat :ci: Nat Na :CI:…
A: Chemical bonds are formed between the same or different atoms to give rise to chemical compounds.…
Q: lon X has an equilibrium potential of Ex = -50 mV. At the resting membrane potential (-70mV), which…
A: Ions can move either way across a membrane but the direction of movement depends on membrane…
Q: During starvation, the glycerol backbone of triacylglycerols can be used to make glucose. What…
A: Gluconeogenesis is the pathway by which glucose is formed from non-hexose precursors such as…
Q: Part A Determine the amino acid sequence of a peptide section of beta-amyloid containing 10 amino…
A: Amino acid sequences are written with N-terminal amino acid on the left and C-terminal amino acid on…
Q: Which of the following does NOT bind to GABAA receptors? O A. ethanol. OB. Pentobarbital. OC.…
A: Neurotransmitters are signalling molecules that usually bind to ion channels and allow ions to flow…
Q: In prokaryotic RNA synthesis the rate of incorporation of nucleotides is constant throughout the…
A: In prokaryotes, RNA synthesis is carried out the enzyme RNA Polymerase. RNA Polymerase read the DNA…
Q: Thiopurine S-methyltransferase (TPMT) is an enzyme that is responsible for the metabolism of the…
A: Proteins are large biomolecules made up of amino acid residues linked via a peptide bond. Amino…
Q: In kilodaltons (KDa), what is the predicted molecular mass of the protein encoded by this gene…
A: Molecular weight of the protein can be calculated by adding the molecular weight of the individual…
Q: Ammonia enters the urea cycle as: OA) aspartate. OB) glutamate. OC) carbamoyl phosphate. D) NH4*.
A: The urea cycle is the main metabolic pathway involved in the removal of nitrogenous waste that is…
Q: hat will happen to CRH secretion in a patient given very high doses of a synthetic glucocorticoid…
A: Glucocorticoids (or, more colloquially, glucocorticosteroids) are a type of corticosteroid, which is…
Q: What is the function of uncoupling proteins in hibernating mammals? ○ A) They allow protons…
A: Uncoupling protein 1 or UCP1 (thermogenin) and is important in helping animals keep warm during the…
Q: 1 Describe the difference between amylose and amylopectin. 2 what is the monosaccharide that…
A: Chemically, carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula :…
Q: Paper electrophoresis of Asn, Ala, Asp, Lys and Ser mixtures at pH = 7 shows the fastest movement…
A: Since you have posted multiple questions, we will provide the solutiononly to the first question as…
Q: Discuss the chemiosmatic mechanism of coupling between electron transport and oxidative…
A: Chemiosmosis is the process of movement of ions across a semipermeable membrane down its…
Q: 1 Draw the following polypeptide: Met- Tyr-Val-Ser-Asn 2A Draw the hydrolysis of a dipeptide…
A: A peptide is a chain of amino acids, in which the amino acids are joined together through peptide…
Q: myristic acid (14:0) carbon dioxide and water a. how many moles of ATP produced from 1 round of the…
A: Myristic acid is found in human cellular membranes at much lower levels than its longer chain…
Q: Calculate AG for ATP hydrolysis in muscle at 16 °C. Use the muscle concentrations from the first…
A: Standards free energy change calculated at biochemical standards is called biochemical standard free…
Q: The hormone, glucagon, is released in the body when glucose levels are low. Briefly describe how…
A: In response to changes in blood glucose levels, the pancreatic cells secrete two peptide hormones:…
Q: 3.(12pts) What is the ratio of NH4+/NH3 for a 0.5M solution of NH4Cl at pH 9? (The pKa of NH4+ is…
A: Dissociation of a weak acid is mathematically described by the Henderson-Hasselbalch equation: pH =…
Q: Enzymatic Saccharification Saccharomyces cerevisiae/Turbo Yeast Preparation of Fermentation Saba…
A: Saba peels are the banana peels that are often regarded as waste. Turbo yeasts are a special strain…
Q: Which effector has less affinity for the fetal Hb subunity?r of a. 2,3-BPG V ([2]+1) \ ([2] _V) = V…
A: Enzymes are high molecular-weight protein molecules that catalyse biochemical reactions. The…
Q: What is ATP? Explain in two sentences. 2. How is ATP produce in Glycolysis? Kreb Cycle? Electron…
A: Individual cells release energy through the process of cellular respiration, which involves the…
Q: 2. Please give the occurrence of Isoflavone s? What is the different between Isoflavone s and…
A: In order to minimise the risk of serious chronic diseases, phytochemicals—which are classified as…
Q: If the AH for a reaction is -4 kJ/mol and the AS is 20 J/(molK), which of the following statements…
A: Standard free energy of a reaction is calculated in order to quantify the spontaneity of a reaction…
Q: The carbon-carbon bond distance for single-bonded carbons, such as those in a saturated fatty acyl…
A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons. The…
Q: Examples of second messengers Steroid hormones Prostaglandins and leukotrienes NO and CO…
A:
Of those in the following list, which organ(s)/tissue(s) is/are affected by mutations in this gene CAGATTGTGAAGAGGTCTCTTGA? select all that apply
a. pancreas
b. skin
c. heart
d. eyes
e. spine and skeleton
f. colon
Step by step
Solved in 2 steps
- Mutations within this gene CAGATTGTGAAGAGGTCTCTTGA are causative of which human diseases? A. mucopolysaccharidosis type II B. Turcot syndrome C. Haemophilia A D. Xeroderma pigmentosum E. Haemophilia B F. Ataxia Telangiectasia G. Noonan syndrome H. Li-fraumeni syndrome I. Hunter syndrome J. Ocular motor apraxiaWhich of these describes the symptoms of the disease(s) caused by mutations in KMT2D ? Select all that apply. Papules Joint hypermobility Sleep disturbance Progeria Dental abnormalities Scoliosisocument/d/1J-wo90GpYsd_jQSUBtDQHWisqGvSOteUQYoXaXazyS0/edit uction to cell.. R 1 Summary of Philo... E Petrona Andres Mig.. 2 Translations IXL: Par... IXL - Translations: g.. 1 IXL- meostasis Lab Exercise Tools Add-ons Help Last edit was 2 days ago text Calibri 12 BIU Conclusion: 1. List the changes you observed in the body color and perspiration level in response to? 2. Explain how the changes help the body adjust to maintain equilibrium (homeostasis)? 3. Speculate why a change in body temperature occurs? 4. Name which mechanisms your body uses to maintain a constant body temperature? 5. Explain why an increased breathing rate accompanies exercise? 6. Explain why an increased heart rate accompanies exercise? 7. Write a paragraph about the conclusions you can draw about your body's ability to maintain equilibrium (homeostasis). Be sure to include the answers to the questions above.
- The rectangles under each cell type shows 4 different genes. If the gene is expressed (used) in that type of cell the box is blue. If that gene is not expressed (used) in that type of cell the box is unfilled. Cyghe Mr Compan n wadproduton ory Cell type Red blood Muscle Pancreatic Gene type Housekeeping Hemoglobin Insulin Myosin You don't really need to know what the different genes do but here is that info anyway: Housekeeping genes- genes that allow the cell to do basic functions like cellular respiration. Hemoglobin- A protein that carries oxygen molecules Insulin- A protein that tells cells to absorb glucose from the blood Myosin- A protein that forms muscle fibers. Compare the chromosomes and genes found in the red blood cells and the muscle cells? Are all 4 genes found .on the chromosomes of both types of cells? Note- this question is not asking if the genes are being expressed (just if they are present). etv 26 МacBook Air DII 80 888 F10 F7 F6 F4 F3 & $ 3 4 9. 7 W E R Y G H J K…For which of the following is there clear evidence that a single gene mutation is the cause of the associated disorder? A mutation in the MAOA gene causes aggression A mutation in the HD gene causes Huntington Disorder A mutation in the gene that encodes Happy Hour causes alcoholism A mutation in the Complement Component 4 gene causes Schizophrenia O A mutation in the FOXP2 gene causes speech disordersOriginal DNA Sequence: TACAC CTTGG CGACGACT... MRNA Sequence: Amino Acid Sequence: Mutated DNA Sequence #5 TACACCTT G G GACGACT... (Highlight the change) What's the mRNA sequence? What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? 1. Which type of mutation is responsible for new variations of a trait? 2. Which type of mutation does not result in an abnormal amino acid sequence? 3. Which type of mutation stops the translation of an mRNA molecule? NO
- people with osteogenesis imperfecta have a dominant mutation in one of the two genes that produce type 1 collagen. people with OI have weak bones, bkuish color in teh whites of eyes, and a variety of afflictions that cause weakness in their joint and teeth. However, some people can carry the mutation but have no symptoms. Thus, families can unknowingly transmit the mutation but does not express the OI phenotype. This is an example of which of the following? a. incomplete penetrance b. variable expressivity c. epistasis d. incomplete dominanceMutations within the genes for ARSs, are known to be cause certain human maladies, such as the neurodegenerative disorder Charcot-Marie-Tooth (CMT) disease along with other central nervous system dysfunctions, and cancer. Interestingly, not all those who possess mutations within specific ARS genes do not display the disease phenotype. Provide at least one reason why a person might survive. Remember, do not just name a concept. Describe the concept and then explain WHY (on a molecular level) this explanation holds true.what is the correct order of the point mutations? a. bafecd b. fcdbea c. dfaebc d. cbadef e. efcadb
- Marfan syndrome is due to a mutation in a gene that encodes aprotein called fibrillin-1. It is inherited as a dominant trait. Thefibrillin-1 protein is the main constituent of extracellular microfibrils.These microfibrils can exist as individual fibers or associatewith a protein called elastin to form elastic fibers. People with thedisorder tend to be unusually tall with long limbs, and they mayhave defects in their heart valves and aorta. Let’s suppose aphenotypically unaffected woman has a child with a man whohas Marfan syndrome.A. What is the probability this child will have the disease?B. If this couple has three children, what is the probability thatnone of them will have Marfan syndrome?Our government has finite funds to devote to cancer research.Discuss which of the following areas of research you think shouldreceive the most funding.A. Identifying and characterizing oncogenes and tumorsuppressorgenesB. Identifying agents in our environment that cause cancerC. Identifying viruses that cause cancer D. Devising methods aimed at killing cancer cells in the bodyE. Informing the public of the risks involved in exposure tocarcinogensIn the long run, in which of these areas would you expect successfulresearch to be the most effective in decreasing human mortalitydue to cancer?Are placebos unethical? According to the Declaration of Helsinki, under what conditions are placebos are unethical? Is Angell right to be concerned that researchers may be trying to rollback moral principles in human clinical trials?