2200cleave20001800I 1/V R1600• 1/V D140012001000800600400200rly.-1 0 156.8.1011y.1/S (uM)-1ts resulted in a kcat of 79 min1 and a KM of 87 µM.urk plots (using kcat for the M-M plot and Vmax forletely.1/V (uM x min-1)-1 1/V (uM x min-1)-11. To the right is a Lineweaver-Burk plot for an enzyme that can cleaveboth DNA (D) and RNA (R).220020001800a. What is the KM when cleaving DNA?I 1/V R1600• 1/V Db. What is the KM when cleaving RNA?14001200C. What is the Vmax when cleaving DNA?Z 1000800d. What is the Vmax when cleaving RNA?600e. On the graph, draw an appropriate line for a400noncompetitive inhibitor for cleaving DNA. Label clearly.f. On the graph, draw an appropriate line for anuncompetitive inhibitor for cleaving RNA. Label clearly.2008 10 111/S (µM)-1

Name: 2200cleave20001800I 1/V R1600• 1/V D140012001000800600400200rly.-1 0
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 2200cleave20001800I 1/V R1600• 1/V D140012001000800600400200rly.-1 0 156.8.1011y.1/S (uM)-1ts resulted in a kcat of 79 min1 and a KM of 87 µM.urk plots (using kcat for the M-M plot and Vmax forletely.1/V (uM x min-1)-1 1/V (uM x min-1)-11. To the ri

Since we only answer up to 3 sub-parts, we’ll answer the first 3. Please resubmit the question and…

Answered: oth DNA (D) and RNA a. What is the KM…

Science

Biochemistry

oth DNA (D) and RNA a. What is the KM b. What is the KM C. What is the Vm d. What is the Vm e. On the graph, c noncompetitiv f. On the graph, uncompetitive

Concepts of Biology

1st Edition

ISBN:9781938168116

Author:Samantha Fowler, Rebecca Roush, James Wise

Publisher:Samantha Fowler, Rebecca Roush, James Wise

Chapter9: Molecular Biology

Section: Chapter Questions

Problem 1ACQ: Figure 9.10 You isolate a cell strain in which the joining together of Okazaki fragments is impaired...

See similar textbooks

Similar questions

ersonal/eenongen_my_tnstate_edu/_layouts/15/doc.aspx?sourcedoc={a6b083c9-a226-4c31... ☆ Search (Option + Q) Review View Help Picture Editing A В ... During nucleic acid hybridization, the probe is labelled Question 1 options: for DNA stability to increase probe-test DNA binding to identify the location of probe and the test DNA binding for amplification Question 2 6. 9. 10 IV 13 14 Which of the following best describes the trait in the pedigree? Question 2 options: X-linked dominant X-linked recessive autosomal domiant autosomal recessive ON
Figure 9.10 You isolate a cell strain in which the joining together of Okazaki fragments is impaired and suspect that a mutation has occurred in an enzyme found at the replication fork. Which enzyme is most likely to be mutated?
1d) Whether done manually or automated, DNA sequencing gels are always made of polyacrylamide rather than agarose. Why can't agarose be used for a sequencing gel, as it is for other DNA gel electrophoresis?
12:26 AM E G M 46 l i72% SCIG10_ACTIVITYSHEET_Q3W4.pdf Let's Evaluate: A. Multiple Choice: Encircle the letter of your chosen answer. For numbers 1-3 refer to the statement: The following is the base sequence on one strand of a DNA molecule: AAT GCC AGT GGT 1. If this strand is replicated, which of the following is the complementary strand that is produced? A. TCG TCC GTC TAG C. TTA CGG TCA CCA B. AGC AGG CAG GGT D. UCG UCC UCU AGA 2. If transcribed into an mRNA, what would be the resulting strand? A. UUA CGG UCA CCA C. AGC AGG CAG AUC B. AGC AGG AGA T C D. TCG TCC GTC TAG 3. During translation, the tRNA sequence of nucleotides arranged linearly is A. TCG TCC GTC TAG C. AGC AGG CAG AUC B. AAU GCC AGU GGU D. UCG UCC GỤC UAG 4. How many codons are needed to specify three amino acids? В. 6 А. 3 С. 9 D. 12 5. Some events that take place during the synthesis of a specific protein are listed below. I. Messenger RNA attaches to a ribosome. II. DNA serves as a template for RNA production. III.…
****0 b D. The Meselson and Stahl experiments demonstrated the mechanism of DNA replication by studying the density of DNA of cells that were first grown in the presence of 15N and then in presence of 14N isotopes. The following Figure "a" shows the results from Meselson and Stahl's experiment of DNA separated by desity gradient centrigugation. The lighter DNA is on the left and the heavier DNA is found on the right in the figure below. The Figure "b" shows the spectrum of the heavier DNA peaking on the rightside and the lighter one pearking on the leftside. Briefly, explain how the semiconservative mode of DNA replication is supported by their experimental results and what they may have seen if the replication modes were conservative or dispersive. GENERATIONS L. in i 3' Media Topoisomerase |||||||||||| comment Collaborate Helicase Primase 3 5' Replication fork AMAT Single-strand binding proteins 3' RNA primer Format Docum 5'
EcoRI --- 5' G - AATTC 3' 5' AGAATTCCGACGTATTAGAATTCTTAT CCGCCGCCGGAATTCT CATCA 3' 3' TCTTAAGGCTGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5' Number of pieces of DNA , and type of fragment .
HindlII ECORI ECORV BamHI 379 Sall Pstl. tet amp Plasmid PBR322 1000 4361 bp ori Ndel If you were going to use this vector to clone a foreign fragment of DNA, what two restriction enzymes would you use to cut the vector, so you could make a recombinant plasmid that has AmpR and KanR (Kanamycin resistance), but No TetR. Assume the insert DNA does NOT have a Tet resistance gene but does have a Kanamycin resistance gene. O EcoR1 and Hindll O Pst1 and Sal1 O Pst1 and Nde1 O EcoR1 and Nde1 f6
1_30*_SP23 - General Biology I (for majors)/1 of us page The anticodon sequence created from the following DNA: TACGGGGCTGAGATT F1 Select one: O a. Tyr-Gly-Ala-Glu-lle O b. AUGCCCCGACUCUAA c. UACGGGGCUGAGAUU O d. Met-Pro-Arg-Leu-STOP F2 # 80 F3 $ 000 000 F4 % F5 MacBook Air F6 & r F7 DII F8
12:49 0 14. You want to amplify the DNA between two stretches of sequence shown in the figure below. Explain which one of the following primer pairs would allow you to amplify the DNA by PCR. DNA to be amplified 5'-GACCTGTGGAAGC -CATACGGGATTGA-3" 3'-CTGGACACCTTCG GTATGCCCTAACT-5" primers (1) 5'-GACCTGTCCAAGC-3 (2) 5-CTGGACACCTTCG-3 (5) 5-CATACGGGATTGA-3" (6) 5°-GTATGСССТААСТ-3° (3) 5'-CGAAGGTGTCCAG-3' (7) 5'-TGTTAGGGCATAC-3" (4) 5'-GCTTССАСАGGTC-3° (8) 5'-TCAATCCCGTATG-3' END 5 THE END
5’-GATCAGCTGACTGGATCCGTCCTCAACGTCAGGATCCAGCTTCAAG-3’ 1. How many cuts do you expect this enzyme to make on the above DNA and how many fragments do you expect to see on your gel? Assume that they are all different sizes.
11:29 Protein 6-10092015113530.pdf https:api.schoology.comv1attachment169963838... Name Class Date 2. How are enzymes involved in this process? 3. hаppens anzips"? 4. Why is it important that exact copies of DNA be made? 5. Suppose that a sequence of one DNA strand is T-A-C-A-A-C-G-T-G. What is the corresponding sequence on the other strand? E Concept Mapping The construction of and theory behind concept mapping are discussed on pages vil-ix in the front of this Study Guide. Read those pages carefully. Then consider the concepts presented in Section 7-1 and how you would organize them into a concept i page 74. Notice that the concept map has been started for you. Add the key Now look at the concept map for Chapter 7 on concepts you are important Secti When you have finished the chapter, you will have a completed concept map. 69 1 of 1
Why is the company Qiagen has more refined DNA extraction steps than a normal Strawberry DNA extraction practical? Summary of Qiagen DNA extraction steps Add ATL buffer and grind with sample. Add 20 microliters of enzyme Proteinase K to degrade protein into a 1.5-2ml microcentrifuge tube. Add 200 microlitres AL lysis buffer, and mix by vortexing for 5–10 seconds, which breaks cell membrane allowing DNA to be released. Incubate the sample at 56 degrees for 10 minutes. Mix the cell lysate with 200 microlitres ethanol by pipetting it at the side of the microcentrifuge wall so DNA precipitates. The DNA forms a white layer and the remaining liquid is discarded. Pipet the mixture into DNeasy Mini spin column placed in a 2 ml collection tube. Centrifuge for a minute at 8000 rpm. Place the mini spin column into a 2 ml collection tube, add 500 µl Buffer AW1, and centrifuge for 1 min at 8000 rpm. Then add it to a new 2 ml collection tube (provided), add 500 µl Buffer AW1, and centrifuge for 1…