Please answer fast Compare the general morphology and importance of the gametophyte and sporophyte generation of bryophytes, seedless vascular plants and seed plants.
Q: 4. Compare and contrast ESCs and iPSCS by considering the following: A) Describe the method of…
A: Over the last few years, biomedical engineering has grown in popularity. Biomedical engineers' new…
Q: thank you and hava a nice day :) Article: Can Nanotechnology Help to Control the Cytokine Storm?…
A: This article is about covid-19 pandemic and how it is responsible for killing so many people. The…
Q: What is meant by a cell cycle checkpoint? -What is its importance? -How does a cell stop it's…
A: Cell cycle refers to the formation of cell from cell. It is quite a complex process that requires…
Q: Explain what a competitive antagonist is using a named example. In your answer, explain why a…
A: Antagonist is a chemical substance like a drug which may block the action of the agonist after…
Q: Describe Scientific Method
A: A research proposal is a document that specifies the aims of the research and the techniques that…
Q: Please explain the difference between complete androgen insensitivity and pe-nis at 12 syndrome.…
A: An uncommon genetic condition of sexual development is known as androgen insensitivity syndrome…
Q: Mrs. and Mr. Bond have five children, Janine, Jaliyah, Joliette, Jelani and James Jr. Mr. Bond…
A: Given information Fragile X syndrome is an X-linked dominant disease. Mr. Bond has this disease…
Q: How does adaptation of the hair cell response occur when the same frequency is sensed? Myosin holds…
A: Myosin is a type of motor protein that is found in muscle tissue. It is responsible for muscle…
Q: BugRx is a new biotechnology company in Cambridge, Massachusetts, developing human monoclonal…
A: Antibodies produced by B cells of white blood cells engage specifically chemically with antigens…
Q: DNA is alway DNA mRNA 5' aal 3 51 PROMOTER AACGCATACGGGATAGCGCCCTGGTTCAAATGGCGGGCCGGCATCCC…
A: One of the core concepts of molecular biology is the flow of information from DNA to RNA to…
Q: Predict what might happen if plants were able to absorb more carbon dioxide. How will this affect…
A: The current level of carbon dioxide concentration in atmosphere (0.03%) is suboptimal for the C3…
Q: Some groups of bacteria can go dormant during periods of environmental stress through the formation…
A: Under stressful environments, some single-cell organisms like bacteria undergo a period of dormancy…
Q: For the following enzymes (3-6) predict how the conditions will most likely affect the enzymes…
A: NADH (Nicotinamide Adenine Dinucleotide Hydrogen) is a coenzyme found in all living cells. It is…
Q: If bioelectrical impedance analysis cannot be carried out, suggest in detail how we can estimate the…
A: A method called bioelectrical impedance analysis (BIA) uses the speed at which an electrical current…
Q: ACTIVITY 2: Protein Synthesis DNA: 3' A G C C G T A GA AТТ 5' 1. Using this strand of DNA as a…
A: Cells create proteins through a mechanism known as protein synthesis. Transcription and translation…
Q: CHOPPY Maleae Gillenieae Kerrieae Exochordeae Sorbarieae Amygdaleae Lyonothamneae Spiraceae…
A: Introduction:- The classification of different organisms is based on the two biological approaches -…
Q: Describe the body’s natural defenses in each of the body systems. Identify the role played by the…
A: The human body has its natural defenses which protect the body from various barriers and external…
Q: Compare and contrast how the endocrine and neural systems do long- distance communication within the…
A: Disclaimer: Since you have posted multiple questions, we will provide the solution only to the first…
Q: Match each component of the immune system that we studied to its role in defending you against…
A: There are mainly two type of immunity; innate immunity and adaptive immunity. Innate immunity also…
Q: How does foliate deficiency Exer enough Evolutionaries pressure to account for a darker skin humans
A: According to the skin mutagenesis theory, skin pigmentation developed as a defence mechanism against…
Q: Normally, the [Select] of our brain is primarily in control of our minds. This is where rational…
A: The frontal lobe, the largest part of the brain, controls personality traits, decision making and…
Q: How is it not The anterior cerebral artery?
A: Anterior cerebral artery is The anterior cerebral artery (ACA) is one of two cerebral arteries( the…
Q: Describe how you can determine if the gene is interrupted, and if so the number of interruptions by…
A: Gel electrophoresis is a technique in which macromolecules such as DNA, RNA or proteins are broken…
Q: a. Explain the purposes of tissue fixation and tissue staining. b. Identify the factors that affect…
A: In this answering session the questions a and b will be addressed, as rest of the questions are…
Q: Please explain whether CAR T-cells alter tumor cells expressing gasdermin -B, -E and -D when anti-…
A: Gasdermin is protein in humans, implicated in human response. It comprises six types in human, that…
Q: How do you feel about the fact that you (the general public), as of today, can purchase biohacking…
A: CRISPR kits are gene-editing kits that enable users to experiment with the CRISPR/Cas9 gene editing…
Q: how does the recently developed dna technology help scientists establish a more accurate…
A: Evolutionary taxonomy is a branch of biology that uses phylogenetic relationships (shared descent),…
Q: Distinguish between innate and learned behavior. Explain how an experiment using optogenetics could…
A: 1.innate behaviorsautomatic, fixed, "built-in", no "learning curve"despite different environments,…
Q: Chloroplast genomes have sequence homology to cyanobacteria genomes. (True or false)
A: Sequence homology is a concept used in molecular biology and biochemistry to describe the degree of…
Q: Which of the following is true about global vision loss? a.Over 80% of vision loss can be prevented…
A: At least 2.2 billion people worldwide suffer from a near- or distance vision impairment. Nearly…
Q: If two species are competing for a resource, and one species is a much better competitor than the…
A: When two individuals of different species compete for food or a nesting site for an extended period…
Q: Again, at the making of this exam, the following numbers represent people that have been infected…
A: Number of infected people in California- 819,782 people Oregon - 33,862 people Washington- 87,522…
Q: For each experimental set up (geotropism and phototropism), identify the dependent and independent…
A: In an experiment the independent variable is the cause and the dependent variable is the effect. The…
Q: 1.Where will a bacteria grow best: glucose, malonate, or gluconate? Explain your answer…
A: Culture media is a gel or liquid that contains nutrients and is used to grow bacteria or…
Q: Name and describe three mechanisms of acquired antimicrobial resistance tools that microbes may use…
A: Acquired antimicrobial resistance. The disease causing microbes acquire resistance towards…
Q: The pathway that can move highest rates of sodium ions is: A. Sodium channels B. Sodium…
A: Sodium ions are necessary in small amounts for some plants, but sodium as a nutrient is more needed…
Q: Prompts Site of Photosynthesis site of Cellular Respiration Site of transcription Site of…
A: Cell is the smallest living unit of life. All living cells perform basic characteristics like…
Q: Explain 3 possible reasons why coral reefs are so diverse?
A: Despite taking up less than 1% of our oceans, coral reefs are one of the planet's most diverse…
Q: If you are going to construct a cDNA library of a plant, will the cDNA library be the same as those…
A: Introduction : The fully transcripted m-RNA molecules of the DNA are known as C-DNA libraries. While…
Q: How to improve the insulin pump “t:slim”, its effectiveness and transport ?
A: The t:slim X2 insulin pump is a smart gadget that releases insulin into the body automatically. It…
Q: Explain how you can determine a suitable antimicrobial for somone who has E. Coli.
A: DISCLAIMER FOR MULTIPLE “Since you have posted multiple questions, we will provide the solution…
Q: What role does the environment play in addressing the needs of society?
A: The environment is a physical area where living things communicate with its non-living elements.…
Q: Which of these would be a first line of defense against microbial infection?
A: Ans : Our immune system has three lines of defense to fight against microbial infection. Those are :…
Q: Regarding the analysis of single marker STR results used in forensic science. Tick all the correct…
A: The true statements among the given statements are: If a suspect's alleles are different from those…
Q: Which of the following are absorbed into epithelial cells of the intestinal villi, but not into the…
A: When you consume food, the digestive system breaks "down protein" into "individual amino acids."…
Q: Using techniques described in this chapter, how could you determine whether Archaea exist in the…
A: Introduction Archaea are single-celled microorganisms that are structurally same as bacteria.…
Q: The human body is composed of eleven different organ systems. Even though each system has a specific…
A: Homeostasis is any self regulating mechanism by which various biological systems tends to maintain…
Q: Cells contain both DNA and RNA. What difference between the structures of these nucleic acids (that…
A: The DNA and RNA are nucleic acids found in the cells. DNA is present in the nucleus while RNA can be…
Q: 5 Multiple Choice Provided below is a dichotomous key for determining the kingdom of an organism. 1a…
A: Answer : a unicellular organism that lives in pond and lacks nucleus would be classified as a member…
Q: In flies, long wings (W) are dominant to short wings (w). Two homozygous recessive are crossed.
A: Genetic inheritance is the process of transfer of gene from the parent to progeny Factor affecting…
Please answer fast
Compare the general morphology and importance of the gametophyte and sporophyte generation of
Step by step
Solved in 3 steps
- Diagram the relationship between the sporophyteand gametophyte generations in bryophytes, ferns,gymnosperms, and angiosperms. Show the relative sizesand physical interactions (if any) of the two generations.Differentiate the reproductive structures and processes of the four plant representatives according to the categories provided. Bryophye Pteridophyte Gymnosperm Angiosperm Female reproductive structure and distinguishing characteristic Male Reproductive structure and distinguishing characteristicDifferentiate the reproductive structures and processes of the four plant representatives according to the categories provided. Bryophye Pteridophyte Gymnosperm Angiosperm TWO distinguishing characteristics of fertilization TWO distinguishing characteristics of embryogenesis
- Give and state general habitats of bryophytes Stomata differentiation between bryophytes and flowering plants.Check the box if it is present or found in the following structure given. Structure Part of Gametophyte Generation Part of Sporophyte Generation Found in Pines Found in Mosses Found in Angiosperm Found in Ferns 1. sorus 2. sporophyll 3. xylem tissue 4. antheridium 5. archegonium 6. flagellated sperm 7. carpel 8. rhizoids 9. roots 10. sporangium 11. pollen 12. wood 13. ovules 14. seed coat 15. coneDraw a generalized pine tree life cycle and identify the following structures: male and female gametophytes, pollen grain, integuments, archegonium, egg, embryo, and sporophyte.
- Give the advantages and disadvantages of having a dominant gametophyte phase in the life cycle of the Bryophytes.The gametophyte of Pteridophytes is inconspicuous in comparison to the mosses. They are also commonly monecious (single house for male and female gamete production). The photo below shows a whole mount (w.m.) of a fern gametophyte at 4x. Make a sketch of the specimen and label the following structures: archegonium, antheridium, mature gametophyte (prothallus), rhizoids AMooD ok DrExplain the life cycle of a fern. Begin with the dominant portion of their life cycle and work your way through the rest including specific names of structures, types of cell division used, and nuclear conditions. Along with your explanation (paragraphs, bulleted points, etc.), I would like for you to discuss in a few sentences how this life cycle is more advanced than a typical moss’s life cycle and, in a few sentences, how it is not quite as advanced as a typical pine’s life cycle.
- The gametophyte of Pteridophytes is inconspicuous in comparison to the mosses. They are also commonly monecious (single house for male and female gamete production). The photo below shows a whole mount (w.m.) of a fern gametophyte at 4x. Make a sketch of the specimen and label the following structures: archegonium, antheridium, mature gametophyte (prothallus), rhizoids MacBThe gametophyte of Pteridophytes is inconspicuous in comparison to the mosses. They are also commonly monecious (single house for male and female gamete production). The photo below shows a whole mount (w.m.) of a fern gametophyte at 4x. Make a sketch of the specimen and label the following structures: archegonium, antheridium, mature gametophyte (prothallus), rhizoidsDescribe the fern sori and Describe the fern gametophyte.