Q: Many manufacturers claim that their health care and hair care products are pH balanced or buffered. ...
A: ANSWER;- So we test their claims is Drop add acids or bases drop by drop compare with water.
Q: What are the conditions under which hemoglobin precipitates out of solution, and how are normal and ...
A: Sickle cell anemia is an autosomal recessive disorder and it affects both male and female offspring ...
Q: Which part of a food label is the primary tool for determining the healthfulness of the product? A. ...
A:
Q: With the help of a schematic diagram describe the haplo-diptontic life cycle pattern in plants. 1.
A: 1. With the help of a schematic diagram describe the haplo diptontic life cycle pattern in plants. I...
Q: Please help with these as they are part of 1 question and I am so confused. I really need help like ...
A: Carrying capacity is the typical population size of a species in a given habitat. Environmental cons...
Q: For selection of recombinants, insertional inactivation of antibiotic marker has been superceded by ...
A: Introduction: Antibiotic resistance is a form of drug resistance where bacteria are able to survive ...
Q: After DNA replication, a eukaryotic chromosome______ . a. consists of two sister chromatids b has a ...
A: The replication process is based totally at the fact that every strand of DNA can serve as a templat...
Q: How many homologous pairs are present in a normal human gamete? Question 4 options: 46 23 ...
A: Chromosomes are cellular , somewhat filamentous structure exhibited inside the nucleus of the cell ....
Q: How are nucleosomes arranged in condensed 30-nm fibers?
A: The main aim of coiling and various kind of measures undertaken, making a complex structure of DNA i...
Q: 6. When can a mutation on the DNA cause production of a longer translation product? Give a specific ...
A: * Types of gene variations Missence Nonsense Frameshift mutation Insertions Deletions Inversions D...
Q: The primary spermatocytes undergo _________ and produce haploid daughter cells in the next region. I...
A: In anisogamous forms of sexual reproduction, sperm is the male reproductive cell, or gamete (forms i...
Q: Which of the following food has the highest satiety value? A. Fiber B. Carbohydrate C. Proteins D. F...
A: Given options all them have satiety value but one has Highest satiety value Foods containing carbohy...
Q: If the result of an unknown bacteria is “poor growth” and “red growth,” can this result be interpret...
A: Since you have asked multiple question, we will solve the first question for you. If you want any sp...
Q: The elements that present in Protoplasm Carbon, Hydrogen Carbon, Hydrogen, Nitrogen, and Oxygen Carb...
A: The living organisms contain cells that are the smallest structural and functional unit of the body....
Q: Give the components, properties and special considerations in preparation (if there's any) on the fo...
A: MacConkey Agar . It is selective for gram- negative rods bacteria. EMB . It is selective for fecal c...
Q: 1- Habitat YY has the greatest species richness. ( choose true or false) 2- The alpha diversity in ...
A: ANSWER;- 1- True, yes Habitat YY has the greatest species richness. 2. False, The alpha diversity i...
Q: In humans, males are heterogametic and females are homogametic, Explain. Are there any examples wher...
A: Answer In humans the 23rd pair of chromosomes contains.
Q: Which of the following will likely result if the concentration of electrolytes outside the cell is h...
A: Osmosis is the movement of solvent molecules across semi permeable membrane along a concentration gr...
Q: Which physiological trigger will result in the sensation of hunger? A. High glucose levels B. Eating...
A: The human body is a complex system of a number of physiological processes. All these processes are i...
Q: What is the functional unit of the chromosome? O RNA O DNA O Gene None of these
A: DNA or deoxyribonucleic acid is the genetic material in living organisms that is present in the nucl...
Q: In humans, males are heterogametic and females are homogametic, Explain. Are there any examples wher...
A: The sexual reproduction involves the fusion of gametes that is male gamete ( sperm) and female gamet...
Q: Please help with these as they are part of 1 question and I am so confused. I really need help like ...
A: Competitive exclusion states that no two species can coexist in the same area for a long time due to...
Q: 4. A population of newts contains 3 yellow newts, 4 spotted newts, 8 stripes newts, and 2 plain newt...
A: Variations : These are the phenotypic characters that makes individuals differ from each other in a ...
Q: The transport of nutrients across a membrane against a concentration gradient using protein carriers...
A: Transport across the membranes: it occurs via either active transport which required direct energy (...
Q: 12. What is the window phase of an infection? How is this concept important for the test of HIV infe...
A: Since viruses lack their machinery so they depend on the host for their replication process. Viral i...
Q: Bacteria that have a composition of CSH702N. Determine the BOD for 30mg/L, following the following f...
A: Microbes, which are tiny and nearly invisible, have had a huge influence on society since the beginn...
Q: Energy that drives the attachment of a nucleotide to the end of a growing strand of DNA comes from__...
A: Synthesis of DNA strand on pre-existing strand is termed as replication. It involves duplication of ...
Q: Bert goes to the gym and works out strenuously for about 45 minutes. After his exercise session he w...
A: 1 cup contains about 16 ounce or 16 tablespoon of water. Replace each pound lost with 16 to 20 ounce...
Q: While working in your lab, you come across four unlabeled boxes that each contain several salamander...
A: 1) Competitive exculsion : Two or more species having same requirements of resources, feeding patter...
Q: 4. Complete this table. Types of mutation: transition, transversion, missense, nonsense, silent CODE...
A: Mutation It refers to the alteration in the sequence of the DNA. It is caused by the mistakes that o...
Q: Including fiber in your diet is beneficial to your GI tract, but consuming excess amounts of fiber c...
A: Fiber serves to maintain cravings and blood sugar levels in check by regulating the body's usage of ...
Q: Choose a syndrome or disorder caused by a mutation. Write the cause, type, and efffect of this mutat...
A: Introduction :- A syndrome is a collection of medical indications and symptoms that are related to o...
Q: Why is pyruvate carboxylase constitutive and active in both glycolysis and gluconeogenesis?
A: The pyruvate carboxylase got multiple sub units of enzymes. Here acetyl CoA helps as an regulatory f...
Q: Can the amount of available energy in a given trophic level be larger than the available energy in i...
A: A pyramid of energy is a graphical representation of the energy found within the trophic levels of a...
Q: Cell Cycle: Sequence of Events The circle represents the life cycle of a cell from its beginning to ...
A: Cell Cycle: sequence of events:- The phases in the reproduction and growth of a cell are known as t...
Q: Several experiments were conducted to obtain information about how the eukaryotic ribosome recognize...
A: A ribosome is a biological unit made up of RNA and protein that functions as the cell's protein synt...
Q: In reverse transcriptase polymerase chain reaction (RT-PCR), an analytical method used to amplify RN...
A: Reverse transcriptase polymerase chain reaction (RT-PCR) is a method used to amplify and sequence RN...
Q: Describe the four properties required of any genetic material.
A: Genome is referred to as the genetic material of an organism that can be DNA or RNA(viruses). The ge...
Q: 3. Inside the treasure chest, you find that whoever last left this treasure had discovered an amazin...
A: We know that enzyme is a biocatalyst that increases the rate of chemical reaction without changing t...
Q: The figure below depicts the start of the CDNA sequence of the gene AGAMOUS from the model plant Ara...
A: Answer--5-CTA AAT GTA CTG AAA AGA AA-3'
Q: Prairie ecosystems are common within continental interiors in the northern hemisphere. These ecosyst...
A: Prairie ecosystem Grasslands and other non-woody plants known as forbs predominate in these habitats...
Q: What factors affect the degree of membrane fluidity?
A: The phospholipid bilayer is composed of two layers of lipids. Each lipid contains a hydrophobic tail...
Q: Between 50-70% of an adult’s body weight is comprised of fluid. A. True B. False
A: Fluids are important for the human body. Water and other minerals play an important role in the body...
Q: Lipid bilayers are said to behave like two-dimensional fluids. What does this mean?
A: The lipid bilayer (or phospholipid bilayer) is a thin polar membrane made of two layers of lipid mol...
Q: 1- Habitat YY has the greatest species richness. ( choose true or false) 2- The alpha diversity in ...
A: ANSWER;- 1. In only two plots species are around 48 and if we take the mean of it then it would be ...
Q: The information travels from one nerve cell to the next in the form of neurotransmitters antigens el...
A: Neurons are the unit of nerve impulse transmission or nervous system. These Impulses are transmitted...
Q: What method will you use to sample a. ground macroinvertebrates b. ground microinvertebrates c. f...
A: An invertebrate is a vertebrate that lacks a backbone. Invertebrates, on the other hand, have no bon...
Q: What is the function of the cell membrane? To control the substances that enter and leave the cell O...
A: Introduction :- The cell membrane, also known as the plasma membrane, is found in all cells and serv...
Q: What role do transposons play in the process of exon shuffling?
A: Introduction Transposons are the short highly repeated DNA sequence present in heterochromatic regi...
Q: Explain the roles of mRNA, tRNA, and rRNA in translation.
A: Ribonucleic acids (RNAs) are one of the important components of cells. It is involved in protein syn...
Give the results, discussion, and conclusion based on the image given.
Step by step
Solved in 2 steps
- 3268 Connexi ANGLAIS FRANÇAIS ARABE Strategies for finding new antibiotics - at least two strategies Envoyer des conWrite a paragraph on Bacteria.express some basic evolutionary relationships among groups of microorganisms i need other answers please explain well do not copy from others or i will downvote
- You grow this weird looking organism in lab and have no idea what it is. You decide to sequence its genome and one of the reads you get back is shown below: >UnknownSequence1 GCGGTATTTGACGCCGCATTCGAAGTGGTCGATCCATTCGGCGTATCAGGACAATTTGCATATGTTGACGTTGTCGCGGGGTGGGCCCTCGATCTGGATGTCGGAGCGGGACGCGGC GAAGATCGGTGTGGCCGATAATGATTGGATCGAGGCGGTCAATCGTAACGGGGTGGTGGTGGCGCGGGCGATCGTGTWhat is the importance of BIOREMEDIATION? Answer atleasr 200-300 wordsWhy is the term prokaryote considered an inadequate descriptor by some microbiologists?
- Different media in bacteriology1-ZA: MICROBIOLOG X Gyes or no Measles is an ex x a A https://docs.google.com/forms/d/e/1FAIpQLScarFK5blZrF4szvrYJcXtBP9s_fgUvBMwqmKjcBQTvY5CaFQ/formRespc Which of the following is TRUE regarding bacteria? Bacteria help produce vitamins in our digestive system Bacteria help clean our intestinal walls and help digest food Bacteria are involved in the production of a variety of foods we consume All of the above are true Which of the following statements concerning viruses and human health is 1 false? in many diseases caused by viruses, the virus attacks cells as it reproduces many viral diseases can be controlled through vaccinations some viruses can remain dormant in the body for years before disease symptoms appear most viral infections are difficult to treat, but they can be finally destroyed by antibioticsThis is a figure from a recent paper comparing different bacterial pathogen strains. What is being compared in this figure? 810 820 830 ATCAAACAGGATTAGATACCCTGGTAGTCCACGC ATCAAACAGGATTAGATACCCT GGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACC AGCAAACAGGATTAGATACCCTGGTAGTCCACC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC ATCAAACAGGATTAGATACCCTGGTAGTCCACAC Staphylococcus aureus Staphylococcus epidermidis Enterococcus faecalis Streptococcus pneumoniae Escherichia coli Enterobacter cloacae Klebsiella pneumoniae Pseudomonas aeruginosa Haemophilus influenzae Bacteroides fragilis Polypeptides Proteins DNA RNA Amino acids
- Naming and Classifying Microorganisms 1. Recognize the system of scientific nomenclature that uses two names: a genus and a specific epithet. 2. Differentiate the major characteristics of each group of microorganisms. 3. List the three domains. A Brief History of Microbiology 1. List at least four beneficial activities of microorganisms. 2. Name two examples of biotechnology that use recombinant DNA technology and two examples that do not. 3. Explain the importance of observations made by Hooke and van Leeuwenhoek. 4. Compare spontaneous generation and biogenesis. 5. Identify the contributions to microbiology made by Needham, Spallanzani, Virchow, and Pasteur. 6. Define bacteriology, mycology, parasitology, immunology, and virology. 7. Explain the importance of microbial genetics and molecular biology.In which Phylum is this organism classified? visuals:unlimftedCats and dogs transfer bacteria onto their fur by: SniffingLickingShakingRunning