Q Search For each statement, indicate if the statement applies to only eukaryotes, only prokaryotes, or both eukaryotes and prokaryotes. cenarate their DNA from
Q: For each, choose either replication, transcription, or translation. Okazaki fragment [ [ Choose ]…
A: The three main processes of central dogma of molecular biology are replication, transcription, and…
Q: IV. Oswald Avery, McCarty and McLeod (Early 1940s) After Griffith's experiment most scientists…
A: Genetic material is nothing but the sequence of nucleic acids which is called as DNA. It contains…
Q: Using the same template strand, transcribe the DNA: GCA TAG CAA TGC
A: Answer: Transcription : It is the process of transcribing DNA to RNA using the template strand of…
Q: Match the term and its description. Each term can only be used once. a series of nonoverlapping,…
A: A codon is a 3 nucleotide sequence triplet unit and each codon codes for specific amino acids. the…
Q: (b) Use a drawing to illustrate the principle of DNA gel electrophoresis.
A: Gel electrophoresis is the technique of separation of molecules on the basis of their size and…
Q: search about Rad54 protein in eukaryotes, and compare with the bacterial system
A: RAD54 is a snf2 related dsDNA specific ATPase essential for homologous recombination mediated by…
Q: Bacterial transformation involves DNA transfer to a recipient cell
A: Answer: Recipient bacterial cell : These are the bacterial cells which receives the DNA in to the…
Q: Draw primary RNA transcript and mRNA. label any modifications that have been made in the structure,…
A: The given sequence is of the dna.this is the coding strand of the template and this consist of…
Q: AKS 5a: Use the table below to answer the question that follows. What is the approximate percentage…
A: A nucleotide is an organic molecule that is the building block of DNA and RNA.They also have…
Q: Match the experiment to the key leaming for each of the following. Record your answers onto the…
A: Nuclein consists of nitrogen and phosphate : extracted from pus covered bandages DNA replication is…
Q: What is a genophore? A DNA in prokaryotes B DNA and RNA in prokaryotes C DNA and…
A: Genophore is a prokaryotic DNA, term coined by Hans Ris.
Q: Translate this DNA sequence using Genetic Code 5' - ATG GGG cCC GTC CAT CCG TAC GCC GGA ATT ATA - 3'…
A: DNA is transcribed into mRNA through the process of transcription. mRNA is then translated into…
Q: From what organelle is this DNA isolated? ATCACGAGCTTAATTACCATGCCGCGTGAAACCAGCAACC Use BLAST to…
A: BLAST (Basic local alignment search tools) is online algorithm and program to compare the biological…
Q: 1. Analyze the following and identify which one mentions the function of a common eukaryotic ligase?…
A: Ligase enzymes are enzymes of Enzyme classification class 6 and it catalyzes the formation of C-C,…
Q: can be found in both? (you can use bullets for your answers) * Caple Pma membrane Ra ar acteta Ragel…
A: The cell is the fundamental, structural,and functional unit of all living organisms. PROKARYOTIC…
Q: Use at least 25 of the 40 terms below to create a concept map, linking the term together with…
A: A concept map is a map that connects the given term. This concept related DNA, to proteins that are…
Q: When a geneticist or microbiologist uses ligase, what is the ligase being used for covalently…
A: DNA ligase is an enzyme that is used to join fragments of DNA by catalyzing the formation of…
Q: AKS 5ct: Use the chart below to answer the question that follows. Which of the models below…
A: Deoxyribonucleic acid (DNA) is a genetic material and it carries genetic information from one cell…
Q: Which of the following processes takes place in the nucleoli within the eukaryotic nucleus?a)…
A: The nucleolus is a round body located inside the nucleus of a eukaryotic cell. It is not surrounded…
Q: Define recognition site. Using examples to support your answer,depict the palindromic nature of…
A: All organisms are made up of cells. Cells are building blocks of organisms. Cells contain hereditary…
Q: Is the genome shown here from a prokaryote or a eukaryote? 11 13 14 15 16 17 18 19 20 21
A: Genome: Genome is a total of genes in an organism. Genes are specific segments of DNA and DNA is…
Q: Explain why the image below could not be from a eukaryote. What characteristics of the image would…
A: Eukaryotes are organisms that has nucleus and organelles within the cell. Nucleus is enclosed in the…
Q: Compare and contrast the mechanisms by which bacterialcells and eukaryotic cells package their DNA.
A: Nucleic acids, DNA, and RNA are composed of nucleotides. Each nucleotide is composed of a…
Q: Compare the basic nature of genetic material in eukaryotes,prokaryotes, and viruses.
A: The genetic material of all organisms is composed of nucleic acids that perform various life…
Q: Consider prokaryotes, choose the CORRECT enzyme/keyword for the following function/role: Binds to…
A: SINGLE STRANDED BINDING PROTEINS binds to single stranded DNA to prevent reforming double stranded…
Q: Discuss the organization of the genetic material in prokaryotes and eukaryot
A: Genetic material is the hereditary material present inside the cell. It carries information…
Q: expalin Yeast centromeric DNA sequences
A: Centromere, also known as kinetochores are DNA sequences that are involved in linking a pair of…
Q: List consensus sequences used in DNA replication, transcription, and translation and compare between…
A: The central dogma of molecular biology describes the two-step process, transcription and…
Q: Complete the DNA and RNA sequencing for the translation and creation of proteins. 3. RNA - AUG AAC…
A: In genetics, translation is defined as the process of converting or translating the sequences given…
Q: Write notes on RAPD, microsatellites DNA, AFLP.
A: Deoxyribonucleic acid (DNA) is a hereditary molecule that passes genetic information from one…
Q: 3. What nucleotide sequence would bond with the following strand? ATCGCCATA VWhy? Use evidence from…
A: The biochemical substance that is carried forward from the preceding generation to the succeeding…
Q: Draw 4 total cycles of the thermal cycler. Begin with one original strand of DNA and show/explain…
A: *Thermal cycler is an laboratory apparatus used to amplify DNA segments through the polymerase chain…
Q: Consider prokaryotes, choose the CORRECT enzyme/keyword for the following function/role: Adds…
A: Asked : Correct enzyme for the given statement
Q: Replicate, transcribe and translate the DNA strand below. Be sure to label your 5’ and 3’ ends and…
A: DNA has two strand, one strand is actively used as a template in the transcription process, this is…
Q: posted 8 months ago (last edited 5 mont Mechanism of Microbial Genetics Prior to the elucidation of…
A: The transcription is the process in which the mRNA copied information from DNA for protein…
Q: INSTRUCTION: = IF BOTH STATEMENT ARE TRUE = IF FIRST STATEMENT IS TRUE WHILE SECOND STATEMENT IS…
A: The genetic instructions that are included in a cell's genes can only be read out, or expressed,…
Q: Create protein sequence with 10 elements. (Start with a codon and ends with a stop codon)
A: Protein sequencing is the cycle of deciding the amino acid arrangement of all or part of a protein…
Q: ween a DNA l
A: DNA Library : It is the collection of DNA sequences from different organisms. cDNA : It is the DNA…
Q: A. Consider the following DNA sequence (coding strand) located near the middle of the coding region…
A: Answer option ll will result in shorter strand
Q: Fill in the blank with the most appropriate term that is described by the following statement: Can…
A: DNA polymerase completes the most common way of duplicating parental DNA to form daughter DNA…
Q: eukaryotes and introns.
A: Several organisms are present in the ecosystem. These include those which can be viewed through…
Q: Explain the processes shown in the image below and explain why it is only possible in prokaryotic…
A: Transcription is a process of formation of the mRNA transcript from the DNA.It takes place through…
Q: A comparison of prokaryotic and eukaryotic DNA would show that prokaryotes have more DNA than…
A: Prokaryotic cell is the primitive type of cell in which membrane bound organelles and we'll defined…
Q: Please explain in detail a chemical reaction between rRNA and another biomolecule
A: rRNA are the structural components of ribosomes. Hence rRNA does not generally participate in…
Q: Translation a. In the diagram above, draw a rectangle around the part that represents translation.…
A: Need to answer the questions related to translation process. Need to determine the step by step…
Q: On the gel diagram below, show how you believe these fragments will sort out during electrophoresis.…
A: DNA is a double stranded helical molecule that is made up of repeating nucleotides. The nucleotides…
Step by step
Solved in 3 steps with 1 images
- Unlike eukaryotic cells, prokaryotic cells ________. a. have no plasma membrane b. have RNA but not DNA c. have no nucleus d. a and cINBan What are the two types of cells? Although cells have some basic parts in common, there are some important differences. The way that cells store their DNA is the main difference between the two cell types. Prokaryotic A prokaryote (proh-KAIR-ee.oht) is a single- celled organism that does not have a nucleus or membrane-bound organelles. Its DNA is located in the cytoplasm. Prokaryotic cells contain organelles called ribosomes that do not have a membrane. Some prokaryotic cells have hairlike structures called flagella that help them move. Prokaryotes, which include all bacteria and archaea, are smaller than eukaryotes. Visualize It! 14 Identify Use the list of terms below to fill in the blanks with the matching cell parts in each cell. Some terms are used twice. DNA in cytoplasm DNA in nucleus Cytoplasm Cell membrane Organelles D C Prokaryotic A CHOPlasm CUNA nucleas F H Eukaryotic A eukaryote (yoo.KAIR.ee oht) is an organism made up of cells that contain their DNA in a nucleus.…9A. Matching cell structures their functionsiutocues) Answer Structures Function Centrioles 1. Composed of proteins and rRNAs Cytosol 2. Region in prokaryotes contains a chromosome Golgi complex 3. ring of nine outer microtubule doublets (9+2 axoneme) Plasma membrane 4. Support the cell and protect against plasmolysis Ribosome 5. Composed of glycoprotein(s) and involved in transferring material into or out of the cell Transporters 6. contain hydrolytic enzymes and involved in autophagy Receptor 7. Composed of microtubules and sweep mucus out of respiratory tract Peroxisome 8. Controls which material can get in or out of the cell Nucleoid 9. Contains chromosomes and has nuclear envelope Cilia 10. Maintain membrane fluidity 11. contains necessary enzymes for that modify, sort, and package of proteins or lipids for extracellular or intracellular use 12. Fluids baths between organelles 13. Is a ligand-binding site and can receive specific signals from out of the cell 14. Contains catalase…
- Specimen Image Specimen Name If it is living, is it eukaryotic or prokaryotic? If it is eukaryotic, is it an animal or plant? Is it living or nonliving? O eukaryotic O prokaryotic O plant O living O nonliving O animal Specimen Image Specimen Name If it is living, is it eukaryotic or prokaryotic? If it is eukaryotic, is it an animal or plant? Is it living or nonliving? O plant O living O nonliving O eukaryotic O prokaryotic O animal Specimen Image Specimen Name If it is living, is it eukaryotic or prokaryotic? If it is eukaryotic, is it an animal or plant? Is it living or nonliving? O living O nonliving O eukaryotic O prokaryotic O plant O animalThe mRNA is loaded onto the ribosome and is read three nucleotides at a time O true False this figure refer to the prokaryotic cell plasma membrane plasmid cell wall pili nucleoid (DNA) Gapsule ribosomes flagellum cytoplasm true O False04.PMA.Blology Which of these comparisons correctly characterizes prokaryotic and eukaryotic cells? OOnly prokaryotic cells have flagella, while only eukaryotic cells have cilia. O Only prokaryotic cells have cell membranes, while only eukaryotic cells have cell walls. OOnly prokaryotic cells have chloroplasts, while only eukaryotic cells have mitochondria. OOnly prokaryotic cells have free DNA, while only eukaryotic cells have membrane-bound DNA.
- 9 Schoology I districtims.seattleschools.org/common-assessment-delivery/start/5381544436?action3Donresume&lsubmissionld=648298410 POSSIB Eukaryotic cells are more complex v than prokaryotic cells. Prokaryotic cells The cell below is Ribosomes Cytoplasm Cell wall Bacterial Flac Capsule Mesosome DNA (nucleoid) Plasma membraneA cell is characterized by the presence of a nucleus, many green organelles, a large water-filled vacuole, and a rigid cell wall. Therefore, it is an example of a cell. prokaryotic animal plant probetMatch each prokaryotic structure with its corresponding function. [Each choice will be used exactly once.] 00 Function as sites of protein production. Region containing long circular double- stranded DNA. Involved in transfer of DNA. Adhere the cell too other surfaces. 1. Fimbriae 2. Pili 3. Nucleoid 4. Ribosome
- Label this figure of a cell. What is the function of each organelle? Is the cell prokaryotic or eukaryotic? How do you know? DO NOT COPY AND PASTE PLEASE!The figure below shows structures found in a(n) in that order. represent and Outside of cell 1 U Work 50 3 Inside of cell 40 2 IDIOS Hoo 55156 Callej The structures labeled 1, 2 and 3 O A. animal; extracellular fibers; kinesin; microfilaments Jocmodesmata: ribosomesDrag the images or descriptions to their corresponding class to test your understanding of the characteristics of prokaryotes, eukaryotes, and viruses. Eukaryote Prokaryote Virus Cell type that lacks a nucleus Size Range: 1-10 pm Must be viewed with an electron. microscope Contains a nucleus and other Acellular particle membrane-bound organelles Size Range: 10- 200 nm Reset