Q: Which is NOT a primate trait: A) Convergent eyes B) Nails instead of claws C) Post orbital bar D)…
A: The question is asking us to identify which of the given options is not a characteristic trait of…
Q: You have 3 populations inhabiting the same landmass. Individuals from the first and second…
A: The biological species concept defines a species as a group of interbreeding individuals that are…
Q: Urgently needed
A: A) In conditions of low tryptophan abundance, the trp operon will not be repressed by the trp…
Q: Discuss how adaptations allowed plants to move from an aquatic environment to the variety of…
A: Key references:1. Evert, R. F., Raven, P. H., & Eichhorn, S. E. (2012). Raven biology of plants.…
Q: What enabled modern humans to colonize the world? Explain what Dan Lieberman means by "Brains and…
A: Approach to solving the question: I hope I was able to help you in elaborating on the topic. feel…
Q: Question 19 Which of the following is FALSE in relation to CRISPR/Cas9? O Cas9 needs a PAM site…
A: Cas9 needs a PAM site consisting of an NGG sequence. True - The Cas9 enzyme requires a short…
Q: Mastery Dawkins, Dominic Unit 8 Test 00 4 5 of 41 < 1 2 3 4 5 6 7 8 9 10 The endosymbiotic theory of…
A: Eukaryote organelles contain DNA similar to bacterial DNAHere's why this is the strongest…
Q: Please answer this four question it Anthro work. Please do it now
A: Approach to solving the question: Detailed explanation:1. B2. Traits:Shape and Size: Human bones…
Q: Discuss, with reference to the biological roles of glucose and oxygen, the full process of aerobic…
A: Approach to solving the question: I hope this helps!. Detailed explanation: Examples: Key…
Q: Considering the advantages and disadvantages of using different drugs, would you allow the use of a…
A: Approach to solving the question:Researched through Books and online resources/ reference with…
Q: In cattle, a mixed coat color occurs in the heterozygous offspring of red (RR) and white (rr)…
A: Answer well explained above
Q: A ALEKS - Julianna Graham - Lex ← -> +…
A: To predict the percentage of DNA that is radioactive after each experiment, we need to understand…
Q: About adaptation plans, which of the following sentences are NOT true? Select two or more: In…
A: The objective of the question is to identify the statements that are not true regarding adaptation…
Q: Consider the following F2 progeny for a 3-point cross, the same cross as presented in question 9.…
A: Here's how to calculate the distance between gene B and gene C in a three-point cross: 1. Identify…
Q: 13 Match each of the QPCR samples (i-v) with the correct amplification plot (A-E) and determine the…
A: Quantitative polymerase chain reaction (qPCR) is a widely used molecular biology technique for…
Q: For which disease active and passive immunization (antibodies) is given simultaneously? Explain how…
A: Approach to solving the question: Detailed explanation: Examples: Key references: Health Science
Q: Describe how a cell fires an action potential and be sure to address which structures are involved…
A: Peer-Reviewed ReferencesBean, B. P. (2007). The action potential in mammalian central neurons.…
Q: Pierre Simon de Laplace claimed that all of the following planets in our solar system are older than…
A: Pierre-Simon Laplace, was a renowned French mathematician as well as astronomer He made important…
Q: Help with question 40
A: 1. Blocks spatial buffering of K+ by astrocytes - This would likely lead to an increase in neuronal…
Q: Urgently needed
A: To answer your questions, we first need to determine the Open Reading Frame (ORF) from the provided…
Q: 4. Which question is best to ask the person in the late stage of Alzheimer’s disease? What dress…
A: Individuals in the late stages of Alzheimer's disease frequently struggle with decision-making and…
Q: Please answer question number 3 and 7 now it Anthro work
A: Approach to solving the question: Detailed explanation:Question 2 OsteoarthritisQuestion 3:To…
Q: Genes M and N are 8.0 map units apart on one chromosome. Genes R and S are 7.5 map units apart on a…
A: Detailed explanation:Recombination is the process by which information is exchanged between…
Q: Please explain this. Below is the payoff matrix for a two-player-two-move game. If…
A: ConceptThe Prisoner's Dilemma in game theory is where two rational individuals might not cooperate,…
Q: Can someone example why it’s dctp im confused ;&;;$;;$;$$:
A: 1. Before DNA replication begins, the double-stranded DNA molecule must unwind and separate into two…
Q: 5. It is the responsibility of every employee to recognize and prevent harassment as soon as…
A: True. It is the responsibility of every employee to recognize and prevent harassment in the…
Q: How do oxygen minimum zones (OMZs) which are subject to constantly low concentrations of oxygen,…
A: The development of Oxygen Minimum Zones (OMZs) is a complex process that involves both biological…
Q: Provide one example by which dysregulation of the oxytocin system may affect mental health wellbeing
A: Social anxiety disorder (SAD) is a prevalent mental health condition characterized by intense fear…
Q: Regarding optic ataxia, what is its clinical etiology, symptoms, and treatments. What are the…
A: Etiology (Causes)Brain Regions Involved:• Parietal Lobe: This region integrates visual and motor…
Q: How do we reduce the use of pesticides in farming?
A: The objective of the question is to understand the various methods that can be employed to reduce…
Q: 4. Analysts believe that Manufactured Earnings is a "darling" of Wall Street analysts. Its current…
A: Let's dissect the computation in detail. The Gordon Growth Model can be used to predict the market's…
Q: The following image is a scheme for serial dilutions prepared for spectrophotometric analysis. If…
A: Step 1:Step 2:Step 3:Step 4:Step 5:
Q: True or false: all protists have a nucleus
A: The question is asking whether all protists, a diverse group of eukaryotic microorganisms, have a…
Q: Briefly discuss common sexually transmitted bacterial infections, with signs and symptoms and…
A: 1. Chlamydia:Causes: Chlamydia trachomatis, a bacteriumTransmission: Primarily through unprotected…
Q: of the given answers What are the possible sex chromosome combinations for children with the…
A: The question is asking about the possible sex chromosome combinations in children with congenital…
Q: Three (3) true positives (antigen is present and patient's sera reacted) and three (3) true…
A: The question is asking about the significance of having three true positives and three true…
Q: make sure it’s correct i need asap
A: Detailed explanation:Mark-recapture approach is suggested to determine the size of a sockeye salmon…
Q: What is the legal basis for lawsuits filed as a result of a transfusion? Question 5 options:…
A: The objective of the question is to identify the legal basis for lawsuits that are filed as a result…
Q: 4. If you are accused of harassment at work, what should you do? Meet with the accuser as soon as…
A: The most appropriate option in this scenario would be: Cooperate with the investigation the company…
Q: An example of dosage as it applies to blood group antigens is: Question 2 options:…
A: The concept of dosage in the context of blood group antigens refers to the phenomenon where the…
Q: make a pathophysiology flow chart of Upper Respiratory Tract Infection with a data of: 3 months old…
A: The objective of the question is to understand the pathophysiology of an Upper Respiratory Tract…
Q: According to Stephen Hales, if systolic blood pressure in the brachial artery (SBP) = 150 mm Hg, and…
A: The objective of the question is to calculate the mean arterial pressure (MAP) given the systolic…
Q: Clara was solving the equation 4n+2−3(2−n)=31 the work for which is shown below.
A: Clara is solving an equation, which means she's trying to find the value of "n" that makes both…
Q: make sure it’s correct i need asap
A: To graph the data and identify survivorship type, possible density-dependent factors, and…
Q: During cellular respiration, approximately 34 ATP are produced from one molecule of glucose. a. How…
A: Let's break down how each stage contributes to ATP production: ATP made during glycolysis:Although…
Q: please help
A: The name of the compound is 1,4-Cyclohexanediol1,4-Cyclohexanediol is a chemical compound with the…
Q: Many cases of drug overdose involve which of the following? the taking of the…
A: The question is asking about the common factors involved in many cases of drug overdose. Drug…
Q: What deficiency disease caused by lack of starch in the diet
A: Starch is a complex carbohydrate that serves as a major source of energy in the human diet. While…
Q: How many protons are present in the atomic nucleus of nitrogen (based on the atomic number)? A. 7…
A: The number of protons in an atom is determined by its atomic number. The atomic number is unique to…
Q: Can you please give a basic information on Sertraline?
A: Sertraline is a type of medication known as a selective serotonin reuptake inhibitor (SSRI). It's…
Genetics Q2
Unlock instant AI solutions
Tap the button
to generate a solution
Click the button to generate
a solution
- Question 19 A transversion mutation would be replacing T by: A either A or G BU (c) T D) cQUESTION 16 CRISPR in nature evolved as a "bacterial immune system" or "genetic vaccine" to target infecting viruses. What aspect of the system can we now manipulate so that you can promote *more* transcription of a desired gene? O A nuclease deficient cas9 a single amino acid mutation in Cas9 o edit the PAM sequence supply a DNA template with the cas9/guide RNA use a special guide RNAQuestion #3: CRISPR has been used to cure an individual from sickle cell. Below is a Sanger electropherogram of a sequence from a patient without sickle cell and one with sickle cell. Sequence from a normal individual mmmm Sequence from the diseased individual G T GIIC A GC A Se SCIENCEphe A G A SCIENCE SCIENCEphoto G a) Where is the change in the sequence and what is the consequence to the protein sequence of this mutation? b) Below is an image of the normal and diseased quaternary hemoglobin protein. What is different about the protein shape and why does that structure have a huge impact on its function (please name the function!)? Adult haemogBRAR G G G G A G Sickle Cell haemoglobin S Structure a s RARY COLIBRARY c) If you were to use CRISPR to modify the genome of a diseased individual, to which nucleotides might you design your guide RNA? Why? d) RNA Seq is used to determine off-target effects of Cas9 cleavage. Why is this an appropriate tool to determine these effects? e) Data on…
- Question 7 (2 points) Determine the matching base pairs that RNA polymerase would lay down for this DNA sequence: TGCAGACT *record your answer with no spaces, dashes, or other charactersQUESTION 1 You want to perform PCR on the CDNA of the spike gene from a SARS CoV-2 sample so that you can sequence it. Based on the sequence below, which of the following primer pairs would probably work for PCR of this gene? Spike gene Sequence: 5' ATGTTTATTTTCTTATTATTTTTTACTCTCACTAGTGGTAGTGACCTTGACCGGTGCACCACTTTTGATG ATGTTCAAGCTCCTAATTACACTCAACATACTTCATCTATGAGGGGGGTT TACTATCCTGATGAAATTTT. .. (it's really long so didn't post the whole thing.).TCTTGCTTTGTTGCATGACTAGTTGTTGCAGTTGCCTCAAGGGTGCATGCTCTTGTGGTTCTTGCTGCAA GTTTG ATGAGGATGACTCTGAGCCAGTTCTCAAGGGTGTCAAATTACATTACACATAA 3' Forward primer: 5' - CTC TCA CTA GTG GTA GTG ACC - 3' (Tm = 60.5 °C in a standard qPCR mix) Reverse Primer: 5' GGG TGT CAA ATT ACA TTA CAC ATA - 3' (Tm= 59.6 °C in a standard QPCR mix) Forward Primer: 5'- ATG TTT ATT TTC TTA TTA TT -3' (Tm=D 47.2 °C in a standard qPCR mix) Reverse Primer: 5'- GCA AGA ACC ACA AGA GCA TGC ACC -3' (Tm= 68 °C in a standard qPCR mix) Forward primer: 5' - CTC TCA CTA GTG GTA GTG ACC -3'…QUESTION 17 OL NEere interested in generating a PCR amplicon including the bracketed sequence below. Which of the following sequences would be canen hybridizing (annealing) with the target AND would also serve to generate a copy of the bracketed region of interest? 5'-AATCGT[AGCAGCAGCAGTGGCT]A AGCT-3 3' -TTAGCA[TC GTC GTC GTC ACC G A] TTCG A - 5' 3-TTAGC-S S-AATCG-3 OSAAGCT-3 5-AGCTT-3 5-GCTAA-3 5-TCGAA-3 QUESTION 18 Vhich of the following is/are true regarding the enzvme PRIMASE? Save and Submit to save and submit. Click Save All Answers to save all answers.
- Question 38 Introns were discovered by matching O MRNA to DNA protein to DNA MRNA to protein none of the above A Moving to another question will save this response. DO00Question 6 There is an addition of Adenine in the MRNA sequence specifically at AUG codon. missense mutation O nonsense mutation O silent mutation O frameshift mutationQUESTION 6 To verify the is indeed inside your plasmid, you'd like to do a colony PCR. But you need primers for your reaction. Which of the following primer pairs would probably work for verifying your insert is actually present in the plasmid? 5' ATGTTTATTTTCTTATTATTTTTTACTCTCACTAGTGGTAGTGACCTTGACCGGTGCACCACTTTTGATG ATGTTCAAGCTCCTAATTACACTCAACATACTTCATCTATGAGGGGGG TTTACTATCCTGATGAAATTTT (Very long, but a bunch of nucleotides her e).... TCTTGCTTTGTTGCATGACTAGTTGTTGCAGTTGCCTCAAGGGTGCATGCTCTTGTGGTTCTTGCTGCAA GTTTGATGAGGATGACTC TGAGCCAGTTCTCAAGGGTGTCAAATTACATTACACATAA 3' Forward: 5' GGT AGT GAC CTT GAC CGG 3' Tm= 59.8 O A. Reverse: 5' CAA ATT ACA TTA CAC ATA A 3' Tm= 47.4 Forward: 5' ATG TTT ATT TTC TTA TTA TTT 3' Tm= 47.1 C O B. Reverse: 5' TAT GTG TAA TGT AAT TTG ACA CCC 3' Tm3 58.4 Forward: 5' GGT AGT GAC CTT GAC CGG 3' Tm3 59.8 OC. Reverse: 5' GTG TAA TGT AAT TTG ACA CCC TTG 3' Tm: 59.4 Forward: 5' GGT CAC TAC CAC TAG TGA GAG 3' 59.4 C O D. Reverse: 5' GTG TAA TGT AAT TTG ACA CCC TTG…
- Question 43 The DNA strand that serves as a template during transcription is known (other than "template") as the or noncoding strand. Blank 1 Blank 1 Add your answerQuestion 28 Intrinsic RNA chain termination is determined by specific sequences in the DNA called sites. A supercoil B termination rho binding D template bindingQuestion 25 If one DNA segment has the following base composition, 5-CAGTTAGTCA-3', which of the following sequences is complementary? A 3'-CAGTTAGTCA-5' 3'-TGACTAACTG-5' 3-TGACTAAСTG-5 D 5-TGACTAACTG-3'