Q: Why has research on endocrine disruption spurred so much debate? What steps do you think could be ta...
A: Endocrine glands secrete chemical messengers (hormones), which act as mediators for many bodily func...
Q: The principle of the alkaline method for plasmid DNA isolation is: O A. An acidic solution different...
A: Plasmid DNA isolation by alkaline lysis method This method is the most commonly used method to isola...
Q: 1) In capsule staining, why does the capsules did NOT take in any dye? 2) In endospore staining, w...
A: Stain is a dye used to colour living or dead organelles. Stains are of three types - Acidic Basic...
Q: Using the following expression vector and the insert of interest with flaking region (PCR product of...
A: Restriction enzymes are special of enzymes that cut DNA at specific position. It is mainly used in c...
Q: Some of the most common mutations associated with cancer are found in the small G protein Ras. Oncog...
A: "Genes" are the fundamental unit of heredity. They store genetic information in the form of DNA, whi...
Q: The Dmanisi site in Georgia is important because: Group of answer choices It is a place where H heid...
A: Introduction: Evolution involves the gradual changes from simple to more complex forms. Humans are b...
Q: 5 RIM Habitat Isolation ,Temporal Isolation , Behavioral Isolation , Mechanical Isolation , Genetic...
A: The organisms of similar species are isolated and this happens when there is something between the l...
Q: A drug called garcinol, is isolated from Garciniaindica (a fruit-bearing tree commonly known as koku...
A: Garcinol is a benzophenone derivative that has been polyisoprenylated. It has phenolic hydroxyl grou...
Q: Describe the three body forms typical of animals
A: The animals can be classified based on their body symmetry, these are: Bilateral symmetry Radial sy...
Q: DNA template A complementary DNA primer Single-stranded RNA template Four deoxynucleotides (DATP, dC...
A: Introduction:- The process of determining the sequence of nucleotides (As, Ts, Cs, and Gs) in a mole...
Q: If Acetyl CoA is converted to a ketone, it is likely that which of the following is undergoing gluco...
A: Fatty acids
Q: 1. An albino man whose parents are both normal marries a woman ome of whose parents is normal and th...
A: Albinism is a autosomal recessive transmission pattern disease. Suppose the genotype of Albino is aa...
Q: C. Choose five questions and answer them in tv 1. Compare and contrast the process of diffusion Clic...
A: Ans 1:- Diffusion is the process of movement of substances from higher concentration gradient to low...
Q: If you had a dialysis tube that contained 1.3M sucrose solution and you put it into a beaker contain...
A: Excretion is a core process of the living organism. All the waste products of the body are removed f...
Q: Distinguish between microevolution and macroevolution.
A: Introduction :- Macroevolution is evolution on a large scale; the phrase refers to events that occur...
Q: Discuss the following: Lysogeny establishment in bacteriophage lambda Lysogeny mentainance in bacte...
A: This phenomena is first elaborated and explained by French biologist André Lwoff in the early 1950s....
Q: Assume that a mutation occurs in the gene that encodes RNA pol II. What would be the effect of the m...
A: A "nucleic acid" is a linear polymer of nucleotides that is a component of the cell's information tr...
Q: Sharks and bony fish are classified within the phytoplankton because they are often found in the wel...
A: Introduction :- The bony fish, or Osteichthyes, is a complex taxonomic category of fish with skeleto...
Q: You found a protein called X in colon cancer patients that is over-expressed and is associated with ...
A: Metastasis is the process by which cancer cells spread from the primary tumor site to other parts of...
Q: Why uncut and cut PCR at different position in the agarose gel? which one can be decided accuracy th...
A: *Gel electrophoresis a technique to separate DNA fragments based on their size. *DNA samples are loa...
Q: 1. Is it possible to change either blood buffer capacity or muscle buffer capacity? 2. How does...
A: Buffer capacity: it is a capacity to resist the any change in pH when small amount of acid or base i...
Q: 16 whe Which statement is TRUE for the reciprocal regulation of phosphofructokinase-1 (PFK-1) and fr...
A: Introduction: The process by which the glucose (6C compound) is split into two molecules of pyruvic ...
Q: List and give distinguishing characteristics of members of the Domain Bacteria
A: Bacteria are a diverse group of prokaryotic microorganisms. Bacteria were among the first living for...
Q: A tampered sack of powdered milk was analyzed by getting 50 grams of composited sample and diluting ...
A: Dilution : We know that the solute of the concentration will be decreasing in solution . There is a ...
Q: Indicate the testing procedure for the cortical sensation
A: The purpose of examination of cortical sensation is mainly to see if there is evidence for a lesion ...
Q: With prove explain how Robert Koch was an Interdisciplinary Thinker, and what fields he borrowed fro...
A: Microbiology has gone a long way since the discovery of microorganisms and is now of considerable us...
Q: 6. Genes Mand Nare 34 mu apart. A double heterozygote individual is crossed with an mmnn individual....
A: Distance between M and N 34 map unit That means they are linked. Double heterozygote = MmNn Rec...
Q: Select physiologic factors of the ventilation-aeration system that limit VO2max and aerobic performa...
A: VO2 (or oxygen consumption) is a measure of the volume of oxygen that is used by your body to conver...
Q: In the scientific competition against fixism, what are the main arguments that favor evolutionism?
A: Introduction :- The theory of evolution is founded on the assumption that all species are connected ...
Q: C.
A: A. Hypertonic B. Isotonic C. Hypotonic
Q: 11.The critical decision point at which a cell determines its fate at the end of the G1 phase of the...
A: 11. ANSWER;- d).Restriction point. Explain;- The restriction point (R), otherwise called the Start ...
Q: what does it mean if our Pcr product was 6.1 nanograms per micrometers and our pcr script was 4.9 na...
A: PCR amplification is done to clone the desired molecule of DNA or in other words to obtain a large n...
Q: In the nematode C. elegans, some worms have blisteredcuticles due to a recessive mutation in one of ...
A: Suppressor mutations are defined as the mutations that take place only if there is the presence of a...
Q: Using the new sequencing platforms as examples discuss how DNA sequencing technologies have evolved ...
A: Dna sequencing g is highly essential for the researchers and the scientists to understand different ...
Q: Zonation Examples Species Illustration (according to its zonation) Zone 1 – highly exposed mangrove...
A: Mangrove trees are salt tolerant trees and grow in intertidal regions of tropical and subtropical o...
Q: How could coacervates have facilitated the emergence of life on earth?
A: Introduction: Coacervates were a type of protobionts or prebiotic chemical aggregates. They were col...
Q: 2 How an enzyme catalyzes a reaction 3 A type of cell that is large, complex and contai membrane-bou...
A: Cell organelles are the cellular components. These cell organelles include membrane-bound and non-me...
Q: During the process of DNA extraction with organic solvents (indicate which one/s are correct) O A. D...
A: INTRODUCTION DNA extraction method is an important techniques that involved in the molecu...
Q: mpare and contrast polymerase chain reaction (PCR) to DNA replication
A: The naturally occurring chemical compounds that serve as the primary information-carrying molecules ...
Q: Describe the way gene flow stabilizes allele frequency.
A: The Hardy-Weinberg principle of equilibrium is used for stating that the alleles of a population and...
Q: illustrate the life cycle of the intestinal fluke and the other life cycle of lung fluke
A: There are about thirty species of trematodes (flukes) in the genus Paragonimus that infect both anim...
Q: In which type of rock are you most likely to find a fossil? a. basalt, a dark, fine-grained volcanic...
A:
Q: s evolution important to all living things, and why do we need to adapt to the ever-changing conditi...
A:
Q: Leptospira, Borrelia and Treponema have which of the following in common? Habitat Pathogenic...
A: Spirochetes are enormous motile bacteria with a spiral structure. They are members of the Spirochaet...
Q: Epinephrine stimulates a variety of adrenergic receptors. Which of the following receptors when stim...
A: The adrenergic receptors (α1, α2, β1, β2, β3) are a type of G protein-coupled receptors and many cat...
Q: Q2. Complete the table below with a tick to show which of the following statements describe the mole...
A: Complete the table to describe the molecules.
Q: How did the experiments of Redi and Pasteur refute the spontaneous generation hypothesis?
A: Introduction In this question we will discuss about the Redi and Pasteur experiments
Q: What is speciation?
A: Introduction In this question we will discuss about the speciation.
Q: Please help me answer how much volume of cell suspension needed (for 5*10^4 cells) in microliters. P...
A: For some experiments, it is essential to use the specified number of cells of microbes (or otherwise...
Q: Briefly discuss RNA interference.
A: RNA interference (RNAi) / Post-Transcriptional Gene Silencing (PTGS) It is a conserved physiologic...
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 3 images
- Semiconservative or Conservative DNA Replication If 15N-Iabeled E. coli DNA has a density of 1.724 g/mL, 14N-labeled DNA has a density of 1.710 g/mL, and E. coli cells grown for many generations on 14NH4+as a nitrogen source are transferred to media containing 15NH4+as the sole N-source, (a) What will be the density of the DNA after one generation, assuming replication is semiconservative? (b) Suppose replication took place by a conservative mechanism in which the parental strands remained together and the two progeny strands were paired. Design an experiment that could distinguish between semiconservative and conservative modes of replication.The temperature at which a DNA sample denatures can be used to estimate the proportion of its nucleotide pairsthat are G- C. What would be the basis for this determination, and what would a high denaturation temperature for aDNA sample indicate?5'-[seq]-3' The diagram shows the results of gel electrophoresis for Sanger sequencing. The wells are represented by open boxes and the DNA bands are represented by black boxes. The wells are labeled to show which dideoxy reaction was loaded into each. Write the sequence of the original template strand used for this sequencing reaction, with the 5’ end on the left and the 3’ end on the right.
- What is the melting temp. of the following double-stranded DNA fragment CATCGCGATCTGCAATTACGACGATAA GTAGCGCTAGACGTTAATGCTGCTATTWhat is the melting temp. of the following double-stranded DNA fragment TCAAAAATCGAATATTTGCTTATCTA AGTTTTTAGCTTATAAACGAATAGAT5’-GATCAGCTGACTGGATCCGTCCTCAACGTCAGGATCCAGCTTCAAG-3’ 1. How many cuts do you expect this enzyme to make on the above DNA and how many fragments do you expect to see on your gel? Assume that they are all different sizes.
- oner micro mole of 48 nulceotide dna was synthesised via solid phase .this sample contains salts and dna strands in different lenghts(32-48)nt.what can be possible procedure and instruments to purify and conform only 48 nt dna from the mixture.Not just generic "degradation" or even shorter DNA fragments, what specific structure change in double-stranded DNA does the hyperchromicity effect show?Agarose gels with different average pore sizes areneeded to separate DNA molecules of different sizeclasses. For example, optimal separation of 1100 bpand 1200 bp fragments would require a gel with alarger average pore size than optimal separation of8500 bp and 8600 bp fragments. How do you thinkthat scientists prepare gels of different average poresizes? (Hint: Agarose gels are made in a mannersimilar to gelatin desserts such as JELL-O.)
- Recall the DNA’s three-dimensional model. The DNA is a right-handed helix wherein onecomplete 360 0 turn covers a distance of 34 angstroms (Å) or 3.4 nm and 10 base pairs. As a result, thebase pairs are separated by a distance of approximately 3.4 Å. The diameter of the Watson and CrickDNA molecule is 20 Å.Calculate the average number of nucleotide pairs (or base pairs) per micrometer of DNA doublehelix according to the dimension mentioned above. Round off your answer to the nearest wholenumber. Note also that 1 micrometer = 10,000 angstroms.31.) The following DNA fragment was sequenced by the Sanger method. The asterisk indicates a fluorescent label. *5'------3'-0H 3'------ATTACGCAAGGACATTAGAC---5' A sample of the DNA was reacted with DNA polymerase and each of the nucleotide mixtures (in an appropriate buffer) listed below. Dideoxynucleotides (ddNTPs) were added in relatively small amounts. Lane 1: DATP, dTTP, dCTP, dGTP, ddTTP Lane 2: DATP, dTTP, dCTP, dGTP, ddCTP Lane 3: DATP, DTTP, dCTP, dGTP, ddATP Lane 4: DATP, dTTP, DCTP, dGTP, ddGTP The resulting DNA was separated by electrophoresis on an agarose gel, and the fluorescent bands on the gel were located. The band pattern resulting from nucleotide mixture 1 is shown below. Assuming that all mixtures were run on the same gel, what did the remaining lanes on the gel look like? ( Fill in the gel below.) 3 Electrophoresis Il||I. You wish to perform an electrophoretic resolution of your restriction enzyme–digested DNA. The sizes of the expected fragments range from 100 to 500 bp. You discover two agarose gels polymerizing on the bench. One is 0.5% agarose; the other is 2% agarose. Which one might you use to resolve your fragments? I. What does it mean to “denature” a protein and why is this important for SDS PAGE? II. Describe how you denatured the proteins you used for SDS-PAGE. III. Describe the roles of the primary Antibody and the secondary Antibody during an ELISA test. IV. After the addition of the secondary Antibody, how did you determine which wells contain the Antigen bound to primary Antibody bound to secondary Antibody?