Sanger sequencing originally used 4 lanes in gels. These lanes represented sequences of different lengths obtained by adding: All of the 4 dideoxynucleotides (ddATP; ddGTP; ddCTP; ddTTP), together with all of the 4 deoxynucleotides (dATP, dGTP, dCTP and dTTP), to all of the reaction vials

Sanger sequencing originally used 4 lanes in gels. These lanes represented sequences of different lengths obtained by adding: All of the 4 dideoxynucleotides (ddATP; ddGTP; ddCTP; ddTTP), together with all of the 4 deoxynucleotides (dATP, dGTP, dCTP and dTTP), to all of the reaction vials

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna

Section: Chapter Questions

Problem 14QP: State the properties of the WatsonCrick model of DNA in the following categories: a. number of...

See similar textbooks

Related questions

Q: Which of the following enzymes adds incoming deoxyribonucleotides/deoxyribonucleoside triphosphates…

A: DNA replication is defined as the process by which a molecule of DNA is replicated or duplicated.…

Q: A piece of DNA fragment is sequenced. You clone the the fragment, isolate the cloned DNA fragment,…

A: While deciphering a sequencing gel, we know that it depends on terminating the reaction at 3' end…

Q: please list all possible products in a sequencing reaction using ddGTPA as a terminator based on the…

A: Ans: Chain termination sequencing: It is sanger sequencing method developed by Frederick sanger. The…

Q: Sanger sequencing originally used 4 lanes in gels. These lanes represented sequences of different…

A: Fredrick Sanger developed a method that is referred to as chain termination and dideoxy sequencing.…

Q: Describe the components vital for DNA sequencing with the Sanger method

A: DNA sequencing: The process of identifying the correct order of the four nitrogen bases (adenine,…

Q: In DNA extraction what else might be in the ethanol/aqueous interface? How could you eliminate it

A: Monovalent cations and ethanol play a key role in removing the solvation shell that surrounds DNA,…

Q: List essential components required for the DNA sequencing reaction based on the Sanger method.…

A: DNA sequencing is the process of determining the sequence of nucleotides in a piece of DNA. In…

Q: A linear piece of DNA that is 30 kb long is first cut with BamHI, then with HpaII, and, finally,…

A: The restriction enzyme is a protein and it recognizes a specific sequence of short nucleotides and…

Q: Explain the origin of the signal that is used in the nucleic acid sequencing method known as…

A: Ion torrent technology is a modern genome sequencing method that converts chemically encoded…

Q: Aside from Sanger Sequencing, what are the other DNA sequencing methods that are available today?…

A: Sanger sequencing is a DNA sequencing technology that uses electrophoresis and is based on DNA…

Q: Following a dye terminator DNA sequencing reaction using 2',3'-dideoxynucleotide triphosphates…

A: Dye terminator DNA sequencing is the modern version of Sanger sequencing. It uses…

Q: Answer the following parts: A. When performing classical Sanger or "dideoxy" sequencing, you set up…

A: “Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: List all the components and explain their purpose in the reaction mixture used for the dideoxy DNA…

A: The method of evaluating the sequence of nucleotides (As, Ts, Cs, and Gs) in a portion of DNA is DNA…

Q: Which of the following is true regarding next generation sequencing? 1. Next generation sequencing…

A: Answer Next generation sequencing is a powerful platform that has enabled the sequencing of…

Q: Why is Sanger sequencing referred to as the chain termination method? Select one: a. Sugars on ddNTP…

A: Sanger sequencing also known as the "chain termination method", is a method for determining the…

Q: consider the DNA segment with a sequence: 3'-TACGGTACGGGATTG-5'. if the given DNA sample was…

A: Ion Torrent sequencing is also known by the name of: Ion semiconductor sequencing pH-mediated…

Q: In E.coli, the following enzymes do NOT synthesize the RNA primer for Okazaki fragments?

A: Introduction:- E.coli,like most bacteria, has a single origin of replication on its chromosome. As…

Q: Draw a diagram from gel electrophoresis that illustrates the result of Sanger Sequencing, label…

Q: Explain the difference between sequencing by chain termination and sequencing by synthesis. Which…

A: Chain termination process employs dideoxynucleoside triphosphates (ddNTPs) lacking OH (hydroxyl)…

Q: Sequencing reactions are done in separate tubes for each ddNTP with a radioactive primer. Which…

A: In our Desire primer it is 15 nucleotide long however on gels there are only 10 bands are present…

Q: Cause Would result in the following error Unbalanced nucleotide concentrations a) Sequence errors in…

A: The polymerase chain reaction is the method that is used for making copies of DNA, it is developed…

Q: Sanger DNA sequencing/ dideoxy sequencing was used as shown in the diagram below. The arrow…

A: Sanger's sequencing method. It is a method based on DNA synthesis. In normal DNA synthesis,…

Q: in your word, identify one difference one similarity between 16 S sequencing and metagenomic shotgun…

A: With the advancements in science, different techniques have emerged to sequence the genomes of…

Q: Template DNA: 5’ ATGACGGAATATAAGCTGGTGGTGGTGG---GGCTGCATGAGCTGCAAGTGTGTGCTCTCCTAA 3’ 3’…

A: Template DNA: 5’ATGACGGAATATAAGCTGGTGGTGGTGGGGCTGCATGAGCTGCAAGTGTGTGCTCTCCTAA 3’…

Q: Dideoxysequencing relies on which one of the following choices: A):Random stopping of one of many…

A: Introduction :- Dideoxysequencing is used in sanger sequencing. Sanger sequencing is a DNA…

Q: See the restriction enzyme map below. The total DNA length is 1800 base pairs. If this DNA is cut…

A: An enzyme derived from bacteria that cuts DNA molecules at specified sequences is known as a…

Q: Describe the outcome of a chain-terminator sequencing procedure in which (a) too little ddNTP is…

A: Sanger DNA sequencing is also known as the sequencing process of chain-termination. In addition to…

Q: Sanger sequencing originally used 4 lanes in gels. These lanes represented sequences of different…

A: In manual Sanger sequencing, four PCR reaction are set up, each with only a single type of ddNTP…

Q: DNA QUANTITATION Can you use the spectrophotometer to quantify proteins? Consult related references…

A: Quantitative methods are used to determine the quantity of a substance in a given sample. A…

Q: Ruwaifa want to compares a nucleotide query sequence what option he will opt in BLAST and why?

A: BLAST is Basic local alignment search tool used to compare the queries in a DNA database. They are…

Q: What is the role of a primer in DNA replication? What would happen if you forgot to add a primer in…

A: DNA replication is the process in which a parent DNA is separated and two new strands are formed…

Q: Consider the DNA segment with a sequence: 3'-TACGGTACGGGATTG-5'. If the given DNA sample was…

A: Pyrosequencing is a form of sequencing that works by the principle of DNA replication. The template…

Q: Discuss the main similarities and differences in the nucleic acid sequencing methods known as…

A: DNA sequencing is the process of determining the sequence of nucleic acids, which are the basic…

Q: In a genome project, the following genomic DNA sequences were obtained. Assemble the sequences into…

A: Genome of an organism includes all the cellular DNA of the organism; including nuclear, chloroplast…

Q: Describe the process for shotgun sequencing of a genome. Practice aligning the two sets of sequenced…

A: Two questions have been asked. first question has been answered. To get the answer for your second…

Q: Sequencing reactions are done in separate tubes for each ddNTP with a radioactive primer. Which…

A: Gell electrophoresis is a biological apperatus mainly used in biotechnology or in case of genetic…

Q: Where do you expect to see multiple “Ns” within a sequencing read? a)Within the first 25…

A: Nucleotide sequences have their role in every aspect of genetic machinery. This includes…

Q: Kornberg and his colleagues incubated soluble extracts of E. coli with a mixture of dATP, dTTP,…

A: Introduction DNA replication: replication of DNA is termed as semi conservative. As the two copies…

Q: Give one more example of chemical (besides acids and alkalis) which can also affect DNA stability.…

A: DNA is important as it carries all the cell's information and the hereditary information. This makes…

Q: A 22-kb piece of DNA has the following restriction sites:A batch of this DNA is first fully digested…

A: The restriction enzymes clean the nucleotide fragment at specific sides called the restriction…

Q: In the Sanger (dideoxy) method for DNA sequencing, a small amount of a dideoxynucleotide…

A: DNA sequencing: It is the biochemical method used to determine the sequence of the nucleotide bases…

Q: Using the formulae for dsDNA to calculate g/mol: You have a 4110 bp cloning vector Want to ligate a…

A: The average weight of a single DNA bp is 650 daltons. This can also be represented as 650 g/mol (=…

Q: You have added 4 μl of a 5 μM stock primer to a 25 μl PCR reaction. What is the amount of primer in…

A: To determine the amount of water the lyophilized primer is added and simply multiplied the number of…

Q: The restriction enzyme Haelll has the recognition sequence below and cuts between the G and bases.…

A: restriction enzymes are the specific endonucleases that have a specific site within the DNA sequence…

Q: Image 1. Which 2 primers from the choices provided would work to amplify the DNA sequence given…

A: DNA strand for deoxyribose nucleic acid. It is the genetic material present in the cell.

Q: Kornberg and his colleagues incubated soluble extracts of E. coli with a mixture of dATP, dTTP,…

A: Radioactivity is the spontaneous emission of energy and subatomic particles from certain kinds of…

Q: A student is running gels to sequence a DNA fragment as below. In addition to running four…

A: Sanger's sequencing method. It is a method based on DNA synthesis. In normal DNA synthesis,…

Q: If you have access to the necessary computer software, make asequence file and analyze it in the…

A: The sequencing of genetic information is important for proper study and analysis, and with the…

Q: Suppose that you want to sequence the following DNA fragment: 5′–TCCCGGGAAA-primer site–3′ You first…

A: The sequencing involves replicating the desired sequence to be sequenced in the presence of the…

Concept explainers

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.

Question

Sanger sequencing originally used 4 lanes in gels. These lanes represented sequences of different lengths obtained by adding:

All of the 4 dideoxynucleotides (ddATP; ddGTP; ddCTP; ddTTP), together with all of the 4 deoxynucleotides (dATP, dGTP, dCTP and dTTP), to all of the reaction vials

All of the 4 dideoxynucleotides (ddATP; ddGTP; ddCTP; ddTTP) to the reaction vials; together with one of the 4 deoxynucleotides (dATP, dGTP, dCTP and dTTP), one for each lane, in each vial.

One of the 4 dideoxynucleotides (ddATP; ddGTP; ddCTP; ddTTP) to the reaction vials; one for each lane, together with all of the 4 deoxynucleotides (dATP, dGTP, dCTP and dTTP) in each vial

One of the 4 dideoxynucleotides (ddATP; ddGTP; ddCTP; ddTTP) to the reaction vials; one for each lane

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Sanger sequencing originally used 4 lanes in gels. These lanes represented sequences of different lengths obtained by adding: All of the 4 dideoxynucleotides (ddATP; ddGTP; ddCTP; ddTTP) to the reaction vials; together with one of the 4 deoxynucleotides (dATP, DGTP, DCTP and dTTP), one for each lane, in each vial. O One of the 4 dideoxynucleotides (ddATP; ddGTP; ddCTP; ddTTP) to the reaction vials; one for each lane O All of the 4 dideoxynucleotides (ddATP; ddGTP; ddCTP; ddTTP), together with all of the 4 deoxynucleotides (DATP, DGTP, DCTP and dTTP), to all of the reaction vials O One of the 4 dideoxynucleotides (ddATP; ddGTP; ddCTP; ddTTP) to the reaction vials; one for each lane, together with all of the 4 deoxynucleotides (DATP, dGTP, DCTP and dTTP) in each vial
Sanger sequencing originally used 4 lanes in gels. These lanes represented sequences of different lengths obtained by adding: O All of the 4 dideoxynucleotides (ddATP; ddGTP; ddCTP; ddTTP) to the reaction vials; together with one of the 4 deoxynucleotides (DATP, DGTP, DCTP and DTTP), one for each lane, in each vial. O One of the 4 dideoxynucleotides (ddATP; ddGTP; ddCTP; ddTTP) to the reaction vials; one for each lane O All of the 4 dideoxynucleotides (ddATP; ddGTP; ddCTP; ddTTP), together with all of the 4 deoxynucleotides (DATP, DGTP, dCTP and dTTP), to all of the reaction vials O One of the 4 dideoxynucleotides (ddATP; ddGTP; ddCTP; ddTTP) to the reaction vials; one for each lane, together with all of the 4 deoxynucleotides (dATP, DGTP, dCTP and ATTP) in each vial
Answer the following parts: A. When performing classical Sanger or "dideoxy" sequencing, you set up 4 parallel reactions per template to be sequenced from a specific primer, with each of the four reactions containing a different dideoxynucleotide, and then the four reactions were run in a separate, adjacent lanes on a gel. Why couldn't you combine all 4 dideoxynucleotides with the primer and the template and do the whole reaction in one tube, and then run the set of fragments produced by the reaction mixture on a single lane in an acrylamide gel? B. When doing automated sequencing, on the other hand, all 4 dideoxynucleotides are added to the same sequencing reaction, and run together in a single capillary gel. What's the difference - why can an automated sequencing reaction be done with all 4 dideoxynucleotides mixed together and all the resulting fragments run together, but not a conventional sequencing reaction?
1a) When performing classical Sanger or "dideoxy" sequencing, you set up 4 parallel reactions per template to be sequenced from a specific primer, with each of the four reactions containing a different dideoxynucleotide, and then the four reactions were run in a separate, adjacent lanes on a gel. Why couldn't you combine all 4 dideoxynucleotides with the primer and the template and do the whole reaction in one tube, and then run the set of fragments produced by the reaction mixture on a single lane in an acrylamide gel?
You are sequencing the genome of newly discovered bacterium, and know nothing of its sequence except that it is one single circular chromosome about 6,000,000 bp long. Your raw sequencing data, from two reactions, are given: 5'-ACCGTCGGTTACGCTTAGA-3' 5'-GTTACGCTTAGATAACACAAG-3' Based on this data, give the sequence of one sequence read: Based on this data, give the sequence of one sequence contig: C. So far, the researchers have assembled all the data they have into three sequence contigs. Have they sequenced the whole genome? Briefly explain, in one or two sentences.
Please list all possible products in a sequencing reaction using ddGTP as a terminator based on the following sequence of a template. 3’ – GGGCTATACCTGACCCTC – 5’
A Sanger product of the sequencing of a template DNA is presented +ddTTP +ddATP +ddCTP +ddGTP Mononucleotide Pentanucleotide Trinucleotide Dinucleotide 11-nucleotide Hexanucleotide Octanucleotide Tetranucleotide 16-nucleotide Decanucleotide Nonanucleotide Heptanucleotide 17-nucleotide 15-nucleotide 13-nucleotide 12-nucleotide 18-nucleotide 20-nucleotide 14-nucleotide 19-nucleotide 21-nucleotide 1. Determine the sequence of template DNA 2. Determine the mRNA sequence from this template DNA 3. Determine the the sequence of protein product derived from that DNA
please list all possible products in a sequencing reaction using ddGTPA as a terminator based on the following sequences of a template : 3'-GGGCTATACCTGACCCTC-5'
Draw the structure of a dideoxynucleotide that would be used for DNA sequencing, and explain why they result in chain termination. Write out the sequence of the first 20 nucleotides for the gene shown in the sequencing gel below (remember to start at the bottom of the gel and work upward, from smallest to largest fragments).
Write the complementary sequence for the following DNA sequence, in order from 3' to 5': 5′−CGATATTGAGCTAAGCTT−3′
In 1984, Carolyn Greider was using to set up an experiment to find out the enzyme called telomerase that had the ability to add nucleotide repeats to telomeric region. * DNA oligonucleotide RNA oligonucleotide Crude E. coli cell extract none of the above [32P] dCTP DGTP
All ingredients required for the synthesis of DNA were placed in a test tube. The primer has the sequence 5’-TCGATCA-3’. First determine where the primer will bind to the DNA template given below (Do this by writing the sequence of the primer on top of the template – make sure you find a location that is complementary in sequence and that the primer is antiparallel with respect to the template) and then indicate the nucleotides that DNA polymerase would attach onto the primer as it synthesizes DNA (hint: in which direction does DNA polymerase attach nucleotides onto a primer?) See figure 13.16 in book. 5’-GACGTAGTCTGATGCTAGCATGCTGATCGAAAGAG-3’