Sensors detect the flash of light. DNA polymerase Unused deoxyribonucleotides are cleaved by apyrase. ATP is consumed by luciferase and light is emitted. AMP and PP, are converted into ATP by sulfurylase. Template strand Growing strand 3' TAGGCCTACACTTACGCGAATGT 5' 5' ATCCGGAT 3' dGTP dNTPs dNDPs dNMPs + P₁ PP₁ ATP

Sensors detect the flash of light. DNA polymerase Unused deoxyribonucleotides are cleaved by apyrase. ATP is consumed by luciferase and light is emitted. AMP and PP, are converted into ATP by sulfurylase. Template strand Growing strand 3' TAGGCCTACACTTACGCGAATGT 5' 5' ATCCGGAT 3' dGTP dNTPs dNDPs dNMPs + P₁ PP₁ ATP

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 22P

See similar textbooks

Similar questions

Formation ofa recombinant DNA molecule. GAATTC GAATTC CITAAG CITAAG double-stranded DNA DAATTO DAATTO CTTAA OG CTAA AATT GI AATT CTTAA GAARIC CTTAAG The enzyme that cataly zes the joining of fragments to form recombin ant DNA is: DNA polymerase DNA ligase helicase re striction endonuclease
vvnicn the following statements are correct about the repair of a DNA duplex containing the sequence below that is grown INE coli (select all that apply)? Strand A Strand B GATCTAGCCGGCATCCGAT CTAGATCGGACGTAGGCTA Methyl ✔A. MutH cleaves Strand A O B. DNA repair will result in the bold A in strand B being replaced with a C O C. DNA repair will result in the bold G in strand A being replaced with a T ✔ D. Defect will not be properly repaired in dam(-) E coli O E. The mammalian repair system would also correct the mismatch shown based on the methylation status of the DNA
#1 HindII --- 5’ GTC ↓ GAC 3’ 5’ ACGACGTAGTCGACTTATTAT GTCGACCCGCCGCGTGTCGACCATCA 3’ 3’ TGCTGCATCAGCTGAATAATACAGCTGGGCGGCGCACAGCTGGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
Choose reactions that always require hydrolysis of ATP. Select all that apply. sliding along template strands unwinding of DNA strands by helicase formation of the phosphodiester linkage by DNA ligase unwinding of DNA strands by B2 subunits formation of the phosphodiester linkage by DNA polymerase I
Given the following template DNA strand, what is the correct complementary DNA sequence? 3' CGC AGT GGA CAT TTC 5' O 5' GCG TCA CCT GTA AAG 3' O 5' GAA ATG TCC ACT GCG 3' O 5' GCG UCA CCU GUA AAG 3' O 5' GAA AUG UCC ACU GCG 3'
Compare and contrast the properties of DNA polymerase and RNA polymerase. Drag the appropriate items to their respective bins. can proofread using a 3'-to-5' exonuclease activity polymerize in a 5'-to-3' direction Only RNA can initiate strand synthesis catalyze phosphodiester bond formation to polymerize nucleotides into nucleic acids Only DNA use deoxyribonucleotide triphosphates as substrates can only extend an existing strand Both Reset Help dependent on a DNA sequence template use ribonucleotide triphosphates as substrates
Cynt Classifying mutations A certain section of the coding (sense) strand of some DNA looks like this: $-ATGTATATCTCCAGTTAG-3" It's known that a very small gene is contained in this section. Classify each of the possible mutations of this DNA shown in the table below. mutant DNA 5- ATGTATCATCTCCAGTTAG-3' S-ATGTATATCTCCAGTTAG-3 5- ATGTATATATCCAGTTAG-3' type of mutation (check all that apply) insertion deletion point silent noisy insertion O deletion point silent noisy insertion O deletion point silent Onoisy X G
#4 BamI --- 5’ CCTAG ↓G 3’ 5’ ACGCCTAGGACGTATTATCCTAGGTAT CCGCCGCCGT CATCA 3’ 3’ TGCGGATCCTGCATAATAGGATCCATAGGCGGCGGCAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
of estion 9 t of uestion THCA ▶ Sou 100- HC This reaction is Entropy is THC San Leafly ATA RNA polymerase SSSSSSSSSS ATTOGOGACATAA ATGACGGATCAGCCOCAAG UACUOCCUAGUC RNA Transcript TACTOCCTAGTCGGCOTTCOOCTTAACCOCTOTATIT (In this picture, RNA is being made by complementary base pairing with DNA.) This reaction is → Entropy is ◆
art B-Processes occurring at a bacterial replication fork The diagram below shows a bacterial replication fork and its principal proteins. Drag the labels to their appropriate locations in the diagram to describe the name or function of each structure. Use pink labels for the pink targets and blue labels for the blue targ Replaces RNA primers with DNA nucleotides. Catalyzes phosphodiester bond formation, joining DNA fragments. Leading strand Breaks hydrogen bonds, unwinding DNA double helix. Synthesizes DNA 5' to 3 on leading and lagging strands. Lagging strand Coats single-stranded DNA, preventing duplex formation. Relaxes supercoiled DINA. Synthesizes RNA primers on leading and lagging strands. e Overall direction of synthesis reset ? help
Discuss DNA replication of prokaryotes and please mention all of the enzymes and components listed below. DNA Primase – DNA directed “RNA Pol” which inserts nucleoside triphosphates (NTPs) Primers are oligonucleotides; priming process is the formation of primers DNA Helicase – separates the DNA in advance of the replication fork (in E. coli DNA Helicase II); binds at AT-rich region of DNA; ATP then binds the helicase Single-stranded DNA-binding Protein (SSBP) – no enzymatic activity; does not consume ATP Topoisomerase – alter the supercoiling of double-stranded DNA DNA Ligase – nicking of strands done for replication to continue Okazaki fragments DNA Polymerase – removes primer via 5’ to 3’ exonuclease activity; comes again for 5’ to 3’ polymerization activity (closes the gap between Okazaki fragments) Prokaryotes DNA Pol I – auxiliary enzyme to DNA Pol III; repairs damage; capable of excising pyrimidine dimers; polymerization via single active site that can bind all 4 dNTPs;…
#2 EcoRI --- 5’ G ↓AATTC 3’ 5’ ACG ACGTATTAGAATTCTTA TCCGCCGCCGGAATTCT CATCA 3’ 3’ TGC TGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut: