Test 6- Comparing the DNA (Gene) Code for Dopamine Active Transport Protein Once dopamine triggers a sensation of pleasure, special proteins on the surface of nerve cells, called Dopamine Active Transport Proteins (DATP), begin active transport of dopamine back into the nerve cells so that it can be stored for reuse. The DATP gene carries coded information that is used by neurons to make dopamine active transport proteins. 1. The sequence of DNA bases shown on blue "DATP Gene" sheet represent small parts of the DATP gene DATP Dopamine from a human. The letters represent DNA bases in the DATP gene. Dopamine Active Transport Protein (DATP) Genes Human TT ATT CCGG ATCGAT CGAC GGATATA CTCCG|G|TATTA AT C G AT CGAT CGCCGGATATACTCCGGTAATATC Mouse TC Cat TCCGGATCGATCG CCCGATATACTCCTGTAATATC AT Baboon TCCGGATCGATCGCCGGATATTCTC GGTAATATC 2. Circle the DNA bases on the mouse (pink), cat (green), and baboon (yellow) gene sequences (order of A, T, G, and C's) that are different from the human base sequence. 3. Count and record the number of differences in the DNA base sequences on the data table.

Q: How is a phylogenetic “bootstrap value” calculated? Simplify and show the steps

A: Bootstrap value in phylogenetics is the value out of 100,which is the number of times the same branc...

Q: What are the types of plant geotropisms? Why do the stem and the roots present opposite geotropisms?

A: Introduction :- Geotropism is the movement of plant components in reaction to gravity. Geotropism ca...

Q: In Figure 6-13, explain at the protein level why this heterokaryon can grow on minimal medium

A: Complementation results when two mutated cells combine together to give rise to a wild-type normal p...

Q: How do these work? i. Artificial selection ii. Natural Selection iii. Gene flow iv. Non-random matin...

A: Introduction :- Selective breeding is the process of humans using animal and plant breeding to selec...

Q: Receptor cells that are neurons with sensory dendrites are faster than receptor cells that are separ...

A:

Q: Why are GMOS considered a threat to the environmental safety?

A: Introduction In this question we have to discuss why GMOs considered a threat to the environmental s...

Q: Each one of the different contraceptive methods has its pros and cons. Give an example of a method l...

A: Introduction: The birth control methods which deliberately prevent fertilization are referred to as ...

Q: find an example of a set of genes that have been horizontally gene transferred between bacteria or a...

A: Horizontal gene transfer (HGT) can be defined as the acquisition of genetic material from another or...

Q: Q:-What is a xaxim?

A: Introduction In this question we have to discuss about the xaxim.

Q: If the true inheritance pattern was a normal Mendelian dihybrid cross, it would be more likely to re...

A: * Mendels dihybrid cross : *Dihybrid cross  means crossing  between two different genes that has two...

Q: If the luciferase open reading frame is 1,650 bp in the control plasmid, and the Rel open reading fr...

A: The mRNA is produced from the DNA by transcription process and then this mRNA is used for the protei...

Q: You spread a small amount of a water sample from the environment on an enriched media agar plate. Af...

A: A tip of needle contains millions of micro-organisms, with millions of species and having different ...

Q: What is Parkinson's disease?

A: Introduction In this question we will discuss about the Parkinson's disease.  

Q: How do populations of predators and prey vary in predatism

A: Introduction Whenever a predator population increases, the prey population tends to decrease at firs...

Q: Red-flowering snapdragons are homozygous for allele R1. White-flowering snapdragons are homozygous f...

A: Introduction :- Homozygous inheritance is a genetic condition in which a person inherits the same al...

Q: In your own words, kindly give the function and allowable limit (if applicable) of each of the follo...

A: Kabocha Squash- Kabocha squash is full of nutrients, boosts immune system, prevents diabetes. Treats...

Q: Black body (b) and purple eye (pr) are recessive autosomal mutations in Drosophila. Bridges are cros...

A: b - allele for black body - recessive pr - allele for purple eye - recessive B - wild type for body ...

Q: How do we know that core-promoter elements are importantfor transcription?

A: A gene is the essential physical and functional unit of heredity. They are comprised of DNA (deoxyri...

Q: Explain the features of the Initiator (Inr) elements, BREs, DPEs,and MTEs of focused promoters.

A: The initiator element (Inr), also known as the initiator motif. In a core promoter that functions s...

Q: A glass spreader can be sterilized by dipping in 70 % ethanol and burning of excess False .a True .b

A: Introduction:- Spreaders, also known as cell spreaders, are laboratory instruments that allow sample...

Q: What function do the cysteines serve in the structure of an opioid receptor? (think protein structur...

A: For instance, consider the general mechanism of binding of a ligand molecule to the receptor site. A...

Q: During pregnancy, the fetal circulatory system works differently than after birth.  Answer the foll...

A: Ductus arteriosus, ductus venosus and foramen ovale get closed and transformed into newborn circulat...

Q: Direction: Write TRUE if the statement is correct and FALSE if the statement is wrong. _1. The nervo...

A: Nervous system is the major controlling centre of your body it controls movements , response to envi...

Q: A coat color of a horse is governed by many different gene pairs. Dominant B will give the horse a b...

A: Given that, B is the dominant gene which is responsible for black color and b is the recessive one w...

Q: What analysis is provided by the study of human age pyramids?

A: A population pyramid which is also known as age pyramid is a graphical representation of distributio...

Q: In the phylogeny shown, how many species lack males that grow horns? Threshold mechanism 1 ,Threshol...

A: The correct answer is- a. None

Q: (a) What is resource partitioning? (b) Fully describe an excellent example of resource partitioning.

A: A community consists of a population of different species.

Q: particular bacterium requires techoic  acid in its medium in order to grow. What would the bacterium...

A: B. cell wall

Q: If your body was transmitting a signal between hemispheres of the brain, the signal would travel O a...

A: If your body was transmitting a signal between hemispheres of the brain, the signal would travel A. ...

Q: What makes a species

A: Taxonomy  In biology taxonomy is the classifying group of organisms according to their characters an...

Q: please help 2 questions  1) how can you tell the difference between male and female fruit fly? 2) ...

A: fruit fly also called drosophila melanogaster is an extensively studied fly for genetically linked t...

Q: (0 - E)2 Phenotype Observed Expected Yellow & Non-starchy seeds 470 (#27) # 29 Yellow & Starchy seed...

A: The Chi-square test determines the probability of difference between the observed and the expected v...

Q: how does an organism maintains homeostasis through the interaction of the various organ systems in t...

A: Homeostasis, from the Greek words for "same" and "steady," refers to a self-regulating process by wh...

Q: Make the complementary strand for the following DNA template and label both strands as 5’ to 3’ or 3...

A: Introduction: Adenine binds to thymine and guanine binds to cytosine as they are complementary base ...

Q: In what type of learning does an animal learns to associate one of its own behaviors with a positive...

A: In nature, a much more common form of conditioning is operant conditioning, also called trial-and-er...

Q: Provide two examples using the term “sex” and two examples using the term “gender”

A: The terms sex and gender are generally considered to be interchangeable; however, they can be differ...

Q: Describe the homeostatic mechanisms that Lacy's body would use to counteract the water deficit S.

A: Homeostasis is the maintenance of the steady-state internal environment of an organism in response t...

Q: 13 10 13, ATLAS (caudal view) AXIS (left side) 16 CERVICAL (caudal view)

A: * Turtles reptiles also known as Testudines. *A shell is formed from their ribs. *turtles are divide...

Q: 3 What is Polymerase Chained Reaction (PCR)? How does PCR work?

A: The world as a whole saw a surge of the disease COVID in the year 2020. For the detection of the vir...

Q: Plants have indeterminate growth growth that doesn t stop at a particular age. What limits the growt...

A: Plant cells are eukaryotic cells that have a genuine nucleus, and other progressive membrane-bound o...

Q: Discuss forest management in relation to fire, pests, and climate change, and evaluate sustainable f...

A: Forest management is a branch of forestry concerned with overall management of the forests which inc...

Q: What are the unique anatomical structures observed in birds to carry out the functions of digestion?

A: Introduction :- Large insoluble food molecules are broken down into little water-soluble food molecu...

Q: Which is NOT a reason why the fruit flies make goad model organistrs? simple food requirements they'...

A: Introduction:- Animals such as mice, flies, and monkeys have all been employed in the past for anima...

Q: Some protozoan pathogens form ________ to protect themselves from harsh conditions in the environmen...

A: The protozoa are the single celled eukaryotic organisms that are mostly parasitic in nature. They ar...

Q: Follow the route food takes in the human GI tract and know the organs and their key functions includ...

A: Digestive system is an important component of every animal as it helps to get the nutrition we need ...

Q: List a diversity of ways some simple animals obtain nutrition without a complete digestive tract

A: Biodiversity is an integral part of the biosphere we live in and various animals shows various modes...

Q: What are pioneer species? What is the role of pioneer species?

A: What are pioneer species? Hardy species that are the first to inhabit previously biodiverse steady-s...

Q: Discussion on the challenges using the technology by touching the followings: • Technology challenge...

A: Diabetes It is a disease that is caused when the blood glucose level becomes too high. Blood glucose...

Q: What plant tissues are responsible for supporting of plant?

A: Introduction In this question we have to write the tissues responsible for supporting of plant.  

Q: 10. What is Relative Centrifugal Field (RCF, in g's) in a centrifuge with a rotor radius of 10 cm sp...

A:  

Emotions

Emotions are biologically based psychological conditions caused by neurophysiological changes which are linked to different factors such as thoughts, emotions, behavioral responses, and pleasure or displeasure. These emotions are not similar to moods. The mood is an affective state. Mood depends upon several factors, such as weather, the environment, physiology, etc. Emotions can be beneficial or detrimental depending on the situation. Emotional reactions are simple. Emotional well-being is strongly affected by our well-being, and such feelings are private.