the following mutations silent, missense, nonsense, or frameshift mutations, why? The original coding DNA strand is: 5’-ATGGGACTAGATACC-3’. 2. 5’-ATGGGTCTAGATACC-3’ 3. 5’-ATGGGACTAAGATACC-3’ 4. 5’-ATGTGACTAGATACC-3’ 5. 5’-ATGGGACTAGTTACC-3’

the following mutations silent, missense, nonsense, or frameshift mutations, why? The original coding DNA strand is: 5’-ATGGGACTAGATACC-3’. 2. 5’-ATGGGTCTAGATACC-3’ 3. 5’-ATGGGACTAAGATACC-3’ 4. 5’-ATGTGACTAGATACC-3’ 5. 5’-ATGGGACTAGTTACC-3’

Name: 1. Are each of the following mutations silent, missense, nonsense, or
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: 1. Are each of the following mutations silent, missense, nonsense, or frameshift mutations, why? The original coding DNA strand is: 5’-ATGGGACTAGATACC-3’. 2. 5’-ATGGGTCTAGATACC-3’ 3. 5’-ATGGGACTAAGATACC-3’ 4. 5’-ATGTGACTAGATACC-3’ 5. 5’-ATGGGACTA

Anatomy & Physiology

1st Edition

ISBN:9781938168130

Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble

Publisher:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble

Chapter3: The Cellular Level Of Organization

Section: Chapter Questions

Problem 17RQ: Which of the following sequences on a DNA molecule would be complementary to GCTTATAT? TAGGCGCG...

See similar textbooks

Similar questions

A certain section of the coding (sense) strand of some DNA looks like this: 5'- ATGGGCCACTCATCTTAG-3' It's known that a very small gene is contained in this section. Classify each of the possible mutations of this DNA shown in the table below. I Don't Know mutant DNA 5'- ATG GGCCACAGTTCTTAG-3' 5'- ATG GG CTCATCTTAG - 3' 5'- ATG GGCCACGCATCTTAG-3' Submit type of mutation (check all that apply) ооооо O point O silent O noisy ооооо insertion deletion insertion O deletion Opoint Osilent noisy insertion O deletion ооооо Opoint silent O noisy X S Ⓒ2023 McGraw Hill LLC. All Rights Reserved. Terms of Use | Privacy Center Accessibility
Below is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ 1.Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would this have on the protein? Look up an example for this type of mutation. 2, Assume the 5th and 6th amino acids are removed from the DNA template strand. What type of mutation is this? How would this affect the protein? Look up an example of this type of mutation. 3.Which mutation changes the protein more...a point mutation or a frameshift mutation. Explain your reasoning. 4.What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 5. What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this?…
6a. Given the following mutated sequence (with respect to the normal sequence), what TYPE of mutation occurred: AAGCTTAC
FIGURE 5 shows the base sequence of the DNA before and after mutation. Which of the following are CORRECT about the types of gene mutation? * Normal DNA: CGA TTA CCA TGC ATA CGA TTA ACC ATG CAT A CGA TTA CAC TGC ATA I III CGA TTA CCA GGC ATA II Mutant DNA Types of gene mutation I Base Deletion II Base Substitution II Base Inversion FIGURE 5 O I and Il only O I and III only Il and III only O I, Il and III
BONUS: Why do RNA viruses such as the COVID coronavirus, influenza virus and HIV have much higher mutation rates than DNA viruses such as Herpes viruses? O DNA polymerases which copy viral RNA have much higher mutation rates than RNA polymerases which copy viral DNA O RNA polymerases which copy viral RNA have much higher mutation rates than DNA polymerases which copy viral DNA RNA viral 60S ribosomes make many ore mutations than DNA viral 40S ribosomes O RNA viral gyrases make more mistakes than DNA viral helicases
7a. Given the following mutated sequence (with respect to the normal sequence), what TYPE of mutation occurred: AAGCCGTTAC 7b. Where did the mutation take place?
Give 1 example of diseases arising from each of the following mutations and explain each. Point mutation Frameshift mutation Calculate for the DNA concentration. The absorbance at 260 nm is 0.7 at 1:30 dilution; the absorbance at 320 nm is 0.1. Is the DNA isolated of good quality? The absorbance at 260 nm is 0.7; the absorbance at 280 nm is 0.1; the absorbance at 320 is 0.01. If you do an absorbance reading after plasmid purification and get an A260/A280 of less than 1.8, how could you further purify the sample to get rid of the protein contamination? Is it always necessary to have completely pure DNA? What are some cases where it would or would not be?
25. Given the following mRNA codons and amino acids, construct a polypeptide from this DNA strand. DNA AAT GGT CCA CCG CTG 1TI 111 11 T Ou GGT GGC GIC MRNA Amino Acids UUA = leucine %3D GAC = asparginine GGU = glycine GGC = glycine CCA = proline %3D AMAM b iwi tant neto10 e 2obitoabun St
the one above: Replicate this sense strand to create a double-stranded DNA helix TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT Compare this mutated sense sequence given below to the original one given above and identify and classify all mutations that can be found in this new DNA sequence? TGAGCATGAAACTCACACCGGGGGCAGTTTCGCACTTAGGATTCTTGTACAGGACCTAGTATAACAAGTT 2. Using this mutated DNA strand, express it as a polypeptide by using the correct reading frame. When you get to the stop codon – you may write an “*” to denote the stop codon. 3. How many amino acids were changed in the mutated polypeptide?
Which of the following sequences on a DNA molecule would be complementary to GCTTATAT? TAGGCGCG ATCCGCGC CGAATATA TGCCTCTC
6. The starting sequence of a gene changed from AUGTTCGACGTG, to AUGTTTTCGACGTG What type of mutation is this? To answer the question, please explain: I) what the mutation is? 2) what types of mutation do you know? 3) what are the possible outcomes of mutations? 14
8a. Given the following mutated sequence (with respect to the normal sequence), what TYPE of mutation occurred: AAACGTTAC 8b. Where did the mutation take place?