The main components that make up DNA are Otwo dipeptides a dipeptide and an amino acid O a single strand of nucleotides O two strands of nucleotides

Q: If you were a genetic counselor and had a patient with MERRF who wanted to have a child, what kind…

A: "Myoclonic Epilepsy with Ragged Red Fibers (MERRF syndrome) is a rare mitochondrial disorder." The…

Q: What is the mechanism by which the Alu sequence has become dispersed to many sites in the genome?

A: An Alu elements is a transposable elements also known as the jumping gene . The transposable…

Q: The following DNA sequence is found on a chromosome in rice plants:               5’…

A: Given DNA sequence:  5’ ACCTTGCTCACATGTGGCGTACCTTTCCGTCTATCTGAACAC 3’ Since, this is the…

Q: A 25-year-old man comes to the physician because of a red, painful area of skin on his right leg. He…

A: Introduction  An infection is defined as the invasion of tissues by pathogens, their growth, and the…

Q: 5. In a given population of diploid individuals, two alleles of gene A exist, A and a. Gene A DNA…

A: Introduction:- PCR ( Polymerase chain reaction) is a biophysical techniques which is used to amplify…

Q: A. Glycolysis C. Cellular Respiration (aerobic) D. Krebs Cycle Answer, B. Fermentation E. Electron…

A: As per our company policy, we have to solve three sub parts in case of multiple sub parts. If you…

Q: Which cytosines could be methylated in a typical mammalian genome? Why? 5’-GCCGCGC-3’

A: DNA is the genetic material in living organisms that contain two polynucleotide trends. DNA contain…

Q: Describe the formation of chromosomes

A: Answer: Chromosomes : It is the long thread like structure of proteins and a single molecule of DNA…

Q: What does the antisaccade task measure? A. The ability to inhibit a movement B. The ability to vary…

A: The cerebral cortex is the uppermost part of the brain and contains the majority of the brain's grey…

Q: How was the normal range of phenotypic variation within and between groups so different than it is…

A: The physical manifestation, or traits, of that attribute, is referred to as phenotype. It describes…

Q: Jon performed a pour plate technique to determine the concentration of viable cells in her mother…

A: INTRODUCTION Pour plate technique This technique helps in enumerating bacterial cells in a mixed…

Q: With which kind of antibiotic (static or cidal) would you expect the MIC and MBC to be about the…

A: Each bacterial isolate-antibiotic combination is given a Minimal Inhibitory Concentration (MIC). The…

Q: 18. In tomatoes, tall (D) is dominant over dwarf (d), and smooth fruit (P) is dominant over…

A: A dihybrid cross is a cross in which two traits are involved . Traits are characteristic features…

Q: . What is juvenile hormone mimics.

A: Introduction Hormones are defined as chemical messengers that are secreted or released directly into…

Q: Where do NAD+ and FAD go in the end?

A: Two essential cofactors for cellular respiration are flavin adenine dinucleotide (FAD+) and…

Q: Make or create one question about Speciation and ecology (Nature of species, reproductiva isolation,…

A: When a group within a species separates from other members of its species, it develops its own…

Q: Using the Butterfly stroke in swimming as an example (see video); What is the significance of having…

A: Butterfly stroke It refers to a swimming stroke that is swum on the chest. In this stroke, both arms…

Q: Social inequality, violence, warfare, disease, overpopulation, environmental degradation, lower…

A: Until the advent of agriculture about 10,000 years ago, humans were hunter gatherers. Food supplies…

Q: If you experimentally removed the histones from the cells you are growing in your lab, how would…

A: Histones are extremely basic proteins which are located in the nucleus of eukaryotic cells and are…

Q: How many different DNA sequences could code for amino acid sequence Met-His-Leu-Thr-Trp-Lys?  (Note:…

A: DNA is a hereditary molecule. It carries the genetic information that is passed from one generation…

Q: This is not giving me a direct answer on what color will the eyes be off the offspring??

A: Here homozygous condition of dominant alleles 'BB' and heterozygous condition for dominant condition…

Q: ABO blood type in humans exhibits codominance and has multiple alleles A, B and O- the A and B…

A: INTRODUCTION Blood grouping There are 4 main blood groups A, B, AB and O. The blood group is…

Q: According to Jonathan Drori, angiosperms evolved a "more intelligent" way of reproducing by…

A: Angiosperms are the largest groupof flowering plants on earth. and it is most diverse part of land…

Q: How do neurotransmitters get transported within a single neuron?

A: Chemical signaling allows cells to interact with one another. Various substances, like hormones and…

Q: QUESTION 6 The agouti gene in mice plays a role in determining coat colour. At this locus (a term…

A: The dominant recessive nature of two or more alleles of a gene decides the phenotypes. The genotypes…

Q: When the skin is exposed to sunlight it will produce: Calcium Vitamin D Vitamin C Vitamin D…

A: The skin acts as a shield by preventing the entry of pathogens into the body and protecting the body…

Q: 3. Oops, Amoeba Man (in the Garfield cartoon below) got it wrong! Describe why his eating process is…

A: A sort of cell or unicellular organism having the property to modify its shape, mainly by extending…

Q: In your research lab you are analyzing the activity of a polymerase as it scans along nucleic acids.…

A: Introduction  An enzyme called a polymerase creates lengthy nucleic acid or polymer chains. In order…

Q: 4. Terent. How does the difference between cellulose and glycogen affect their nutritional value to…

A: Complex carbohydrates must be broken down into simple monosaccharides that can be absorbed through…

Q: Based on the group it belongs to, which land plant innovations are possessed by Dicranum scoparium…

A: Introduction Vascular plants, otherwise called Tracheophyta, structures an enormous group of plants…

Q: According to mitochondrial DNA Homo neanderthalensis and modern Homo sapiens diverged around____. a.…

A: Though genetically distant from contemporary humans, neanderthals are more linked to us than chimps…

Q: Describe how moisture affects the growth of microorganisms.

A: There are both harmful and non-pathogenic microbes, which are present everywhere. The body can be…

Q: Which among the following statements is INCORRECT? The first event in the Calvin cycle is the…

A: Calvin pathway occurs in all photosynthetic plants, that is operated in cyclic manner. Calvin cycle…

Q: Question: Which macronutrient does fermentation consume to make the fermented food a)Protein…

A: Introduction Fermentation is the process which occurs in the absence of oxygen. It is a biochemical…

Q: Are there ways to reveal the detailedworkings of a protein machine that donot require the…

A: Proteins are dynamic biomolecules having many functions in the cell. They are the end products of…

Q: During capillary exchange, which of the following occurs only at the arterial end of a capillary?

A: Introduction Capillaries are extremely narrow (less than 1 mm long), microscopic tube with one cell…

Q: During your experiment you analysed only a few of the recombinant clones for the presence of the…

A: A Genomic library consists of the total genomic DNA of an organism. This DNA can be stored inside…

Q: Provide 2 examples of Diffusion, Osmosis, and Semi-Permeable Membrane (1 from the "Diffusion Through…

A: Diffusion and osmosis are quite similar which describes movement of substance from its a region of…

Q: After eating a doughnut, your pancreas produces [ Select] [Select] [Select] " After intense…

A: Glycemia is the assessment of glucose level in blood of people or other animals. It is often…

Q: Explain why the three transformations produce different number of colonies, commenting on the…

A: Transformation is the process of gene transfer into bacteria in which the competent bacteria takes…

Q: if the water potential of a dialysis is -4.0 and pressure potential was -2.0 and the solute is…

A: Introduction :  The term "water potential" refers to the kinetic energy of water. When a solute is…

Q: What is specifically being observed in a Gelatin Hydrolysis Test?

A: Gelatin liquefaction can increase the invasiveness (ability to spread throughout) of microorganisms.…

Q: estion 4 Dictyostelium discoideum is a slime mold used in research. In this species, individual…

A: Introduction :  A species of soil-dwelling amoeba called Dictyostelium discoideum is a member of the…

Q: Which statement about red algae and green algae is correct? A. Red algae and green algae are both…

A: Introduction  Plant-like protists are called as the  algae. red and green algae, euglenids, and…

Q: The Multiregionalism model of modern human origins hypothesizes that____. a. some features of…

A: The evolution of humans is based on different hypotheses. There are two hypotheses which are more…

Q: Modern Homo sapiens are not the only species to use tools. Which other animals use tools? a. some…

A: Introduction: Tool use by animals is a phenomenon in which an animal uses any  different kind of…

Q: Compare the mechanism of ATP production in photosynthesis and cellular respiration (aerobic and…

A: Photosynthesis and cellular respiration are the two very important biochemical processes that are…

Q: why do we use EcoRI plus HindIII rather than BamHI or Sau3AI?

A: Restriction enzymes are enzymes that cut DNA at specific recognition sites. These enzymes are used…

Q: Miles and Misra serial dilution strategy to determine bacterial density (cfu/ml) and if infection is…

A: Miles and Misra's method is also known as viable surface count. This method counts a number of…

Q: State whether a BamHI site has been re-created at the forward- and the reverse-end junctions of the…

A: The end of a DNA fragment ending with BamHi  has a 50% chance of making BamHi junction and 25%…

DNA and RNA

Deoxyribonucleic acid (DNA) is usually called the blueprint of life. Deoxyribose is a monosaccharide that has a key function in the synthesis of deoxyribonucleic acid. One less oxygen-containing hydroxyl group occurs in deoxyribose sugar. Nucleic acid, deoxyribonucleic acid, is one of the natural components. Deoxyribonucleic acid is a double-stranded molecule. Watson and Crick postulated the double-stranded model of the helix. A deoxyribonucleic acid is a molecular group that carries and transmits genetic information from parents to offspring. All eukaryotic and prokaryotic cells are involved.

DNA as the Genetic Material

DNA, or deoxyribonucleic acid, is a long polymeric nucleic acid molecule discovered in the late 1930s. It is a polymer; a long chain-like molecule made up of several monomers connected in a sequence. It possesses certain characteristics that qualify it as a genetic component. Certain organisms have different types of nucleic acids as their genetic material - DNA or RNA.

Genetics

The significant branch in science which involves the study of genes, gene variations, and the organism's heredity is known as genetics. It is also used to study the involvement of a gene or set of genes in the health of an individual and how it prevents several diseases in a human being. Thus, genetics also creates an understanding of various medical conditions.      

DNA Replication

The mechanism by which deoxyribonucleic acid (DNA) is capable of producing an exact copy of its own is defined as DNA replication. The DNA molecules utilize a semiconservative method for replication.