The most common MCAD mutation is shown below. The coding strand is shown for both the WT and mutant. The TATA box and kozak sequences are in parenthesis. What type of mutation is present? Wild-type:5’-ATGGCC[TATAT]ATGTCACTTGACTACGCAGCC[GCCACCATGG]ATATAGATAATGCGCGCATAGCATACTGAGGGTAGTAG-3’ Mutant:5’-ATGGCC[TATAT]ATGTCACTTGACTACGCAGCC[GCCACCATGG]ATATAGATAATGCGCGC AGAGCATACTGAGGGTAGTAG-3’ Answer: Is this a transition mutation? because there is an exchange of G instead of A? It kind of confuses me a little. help

The most common MCAD mutation is shown below. The coding strand is shown for both the WT and mutant. The TATA box and kozak sequences are in parenthesis. What type of mutation is present? Wild-type:5’-ATGGCC[TATAT]ATGTCACTTGACTACGCAGCC[GCCACCATGG]ATATAGATAATGCGCGCATAGCATACTGAGGGTAGTAG-3’ Mutant:5’-ATGGCC[TATAT]ATGTCACTTGACTACGCAGCC[GCCACCATGG]ATATAGATAATGCGCGC AGAGCATACTGAGGGTAGTAG-3’ Answer: Is this a transition mutation? because there is an exchange of G instead of A? It kind of confuses me a little. help

Name: The most common MCAD mutation is shown below. The coding strand is sho
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: The most common MCAD mutation is shown below. The coding strand is shown for both the WT and mutant. The TATA box and kozak sequences are in parenthesis. What type of mutation is present?Wild-type:5’-ATGGCC[TATAT]ATGTCACTTGACTACGCAGCC[GCCACCATGG]AT

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 18QP: The following is a portion of a protein: met-trp-tyr-arg-gly-pro-thr-Various mutant forms of this...

See similar textbooks

Similar questions

A wildtype gene produces the polypeptide sequence: Wildtype: Met-Ser-Pro-Arg-Leu-Glu-Gly Each of the following polypeptide sequences is the result of a single mutation. Identify the most likely type of mutation causing each, be as specific as possible. M1:Met-Ser-Ser-Arg-Leu-Glu-Gly missense mutation M2:Met-Ser-Pro M3:Met-Ser-Pro-Asp-Trp-Arg-Asp-Lys M4:Met-Ser-Pro-Glu-Gly nonsense mutation frameshift insertion in frame deletion M5:Met-Ser-Pro-Arg-Leu-Glu-Gly in frame insertion
Based on the following wild type DNA sequence, indicate if each of the mutations should be classified as : insertion, deletion, missense, nonsense, silent (Use the provided Genetic Code table and remember you have been given DNA sequence). Wild Type: 5’ ATG GCT AGA GTC GAG TTG 3’ Mutant 1: 5’ ATG GCA GAG TCG AGT TG 3’ Mutant 2: 5’ ATG GCT TGA GTC GAG TTG 3’ Mutant 3: 5’ ATG GCT AGA GTT GAG TTG 3’ Mutant 4: 5’ ATG GCT AGA AGT CGA GTT G 3’ Mutant 5: 5’ ATG GCT AGA ATC GAG GTT 3’
MCAD deficiency is an inborn error of metabolism. The coding strand is shown for the wild-type gene. The TATA box and kozak sequences are shown in parenthesis. Wild-type: 5’-ATGGCC[TATAT]ATGTCACTTGACTACGCAGCC[GCCACCATGG]ATATAGATAATGCGCGCATAGCATACTGAGGGTAGTAG-3’ What is the resulting polypeptide from the wild-type protein?
5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. Write the resulting amino acid sequence using the 3 letter code. Write the answer in a all capital letters. Leave a space between the amino acids. Do not write 5' and 3'. 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. If the G in Bold changes to a T, then the result will be A) A nonsense mutation B) A frameshift mutation C) A silent substitution D) A missense mutation 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. If the G in Bold changes to a A, then the result will be A) A nonsenese mutation B) A frameshift mutation C) A silent substitution D) A missense mutation
The DNA sequence of one strand of a gene from threeindependently isolated mutants is given here (5′ endsare at left). Using this information, what is the sequence of the wild-type gene in this region?mutant 1 ACCGTAATCGACTGGTAAACTTTGCGCGmutant 2 ACCGTAGTCGACCGGTAAACTTTGCGCGmutant 3 ACCGTAGTCGACTGGTTAACTTTGCGCG
Identify the following mutations and describe what the possible effect on the protein will be. (4) 5’GAT TTT AGC TTA GCC CAT 3’ 5’ GAT TAG CTT AGC CCA T 3’ 3’CTA AAA TCG AAT CGG GTA 5’ 3’ CTA ATC GAA TCG GGT A 5’ 5’ GAT TTT AGC TTA CCC CAT 3’ 5’ GAT TTT AGC TAA CCC CAT 3’ 3’ CTA AAA TCG AAT GGG GTA 5’ 3’ CTA AAA TCG ATT GGG GTA 5’
The genetic alteration responsible for sickle-cell anemia in humans involves: a transition mutation from A to G, substituting glutamic acid for valine in a-globin a transversion mutation from T to A, substituting valine for glutamic acid in b-globin a transition mutation from T to C, substituting valine for glutamic acid in b-globin a transversion mutation from G to C, substituting glutamic acid for valine in a-globin a frameshift mutation of one ATC codon, removing glutamic acid from b-globin
Help me please
What is the length in AA’s of the LilP protein? Assume fMet is NOT CLEAVED. Enter just the number, nothing else! Write out the sequence of the polypeptide in AA: use the three letter notation, e.g. Met-Ser-Pro- A lilP mutant called lilPXS is isolated that produces a truncated polypeptide of only 6 AA in length. Describe a single basepair DNA change that would lead to this truncated version of the protein. Multiple options are possible (100 words max.)
For the following sequence design the forward and reverse primer... explain and justify your answer. Gene of Interest: a tgaaacaaca aaaacggctt tacgcccgat tgctgacgct gttatttgcg 61 ctcatcttct tgctgcctca ttctgcagca gcggcggcaa atcttaatgg gacgctgatg 121 cagtattttg aatggtacat gcccaatgac ggccaacatt ggaagcgttt gcaaaacgac 181 tcggcatatt tggctgaaca cggtattact gccgtctgga ttcccccggc atataaggga 241 acgagccaag cggatgtggg ctacggtgct tacgaccttt atgatttagg ggagtttcat 301 caaaaaggga cggttcggac aaagtacggc acaaaaggag agctgcaatc tgcgatcaaa 361 agtcttcatt cccgcgacat taacgtttac ggggatgtgg tcatcaacca caaaggcggc 421 gctgatgcga ccgaagatgt aaccgcggtt gaagtcgatc ccgctgaccg caaccgcgta 481 atttcaggag aacacctaat taaagcctgg acacattttc attttccggg gcgcggcagc 541 acatacagcg attttaaatg gcattggtac cattttgacg gaaccgattg ggacgagtcc 601 cgaaagctga accgcatcta taagtttcaa ggaaaggctt gggattggga agtttccaat 661 gaaaacggca actatgatta tttgatgtat gccgacatcg attatgacca tcctgatgtc 721 gcagcagaaa ttaagagatg gggcacttgg tatgccaatg…
In one form of thalassemia, the mutation of a single base from G to A generates a new 3' splice site that is farther upstream from the normal site. The normal and mutated sequences show the sense DNA strands of a normal and thalassemic patient. 5' CCTATTGGTCTATTTTCCACCCTTAGGCTGCTG 3' 5' CCTATTAGTCTATTTTCCACCCTTAGGCTGCTG 3' 3' end of mutated intron New start of reading frame Normal 3' end of intron What is the amino acid sequence of the extra segment of protein synthesized in a thalassemic patient that results from the aberrant splicing? Use the codon table and write the peptide sequence using three-letter amino acid abbreviations separated by hyphens. amino acid sequence: Pro-The-Ser-Leu-Phe-Ser-Thr-Leu-Arg-Leu-Leu Incorrect
What is the sequence of the mRNA transcript that will be produced from the following sequence of DNA? The top strand is the template strand, the bottom strand is the coding strand. 5’ – TCGGGATTAGACGCACGTTGGCATACCTCG – 3’ 3’ – AGCCCTAATCTGCGTGCAACCGTATGGAGC – 5’ Enter the mRNA sequence here (pay close attention to the direction of the molecule!): 5'-_____-3'