Answered: The reason why lions do not develop…

Science

Biology

The reason why lions do not develop scurvy without eating vegetable is that lions eat herbivore animals

An Illustrated Guide To Vet Med Term

4th Edition

ISBN:9781305465763

Author:ROMICH

Publisher:ROMICH

Chapter18: Like Cats And Dogs

Section: Chapter Questions

Problem 25MC

See similar textbooks

Related questions

Q: Humans have 46 chromosomes in each somatic cell. a. How many chromosomes does a child receive from…

A: Introduction:The nucleus has chromosomes, which house the genetic material. Autosomes and sex…

Q: 1. Why flowers develop into clusters? What its taxonomic significance?

A: Flowers are the modification of shoot having limited growth. Flower acts as reproductive organ of…

Q: In which of the three types of co-IP, the antibody elutes with the protein of interest and its heavy…

A: Co-Immunoprecipitation is a technique that relies on the immobilization of antibodies against a…

Q: U.We can largely (more than 50 %) reduce the risk of cancer if we carefully avoid smoking,…

A: Cancer can be described as a group of diseases,in which cell lost the usual control over their…

Q: Identify the plant seen below common name

A: Plant kingdom includes bryophytes, pteridophytes, angiosperms and gymnosperms. The bryophytes lack…

Q: Transcribe the strand below: ACGCTACCGTTAGCCGACATCGGGGACACTGACTCG

A: A DNA fragment is copied into RNA during transcription. Messenger RNA is the term for DNA segments…

Q: How does this organism move?

A: Amoeba is a unicellular organism with shape-changing capabilities. They typically live in bodies of…

Q: How is epigenetic information similar to and different from genetic information? What attributes of…

A: In order to comprehend the form and composition of the genetic sequences and of the resulting…

Q: How can a scientist determine whether a protein with a common origin in bacteria and a fruit fly…

A: Introduction: Generally, proteins with similar sequences perform similarly. The same origin or…

Q: Why would a geneticist study a yeast cell or a fruit fly or a mouse in order to understand human…

A: Human biology is an interdisciplinary area of study that examines humans through the influences and…

Q: CLASS AMPHIBIA-SALAMANDERS, FROGS, & TOADS The hind limbs of the frog are much longer than the…

A: A frog is a tailless, short-bodied amphibian belonging to the big carnivorous group of species. A…

Q: C. SLIDE: Ranunculus mature root xs (Text p. 566) 1. Draw and label: epidermis, cortex, vascular…

A: The Ranunculus belongs to the family Ranunculaceae and is a member of flowering plants. The mature…

Q: Among the affinity chromatography resins below, select the one which purifies proteins that have…

A: Affinity chromatography is a type of chromatography that uses a specific binding interaction to…

Q: How does epidemiologist fit in the field of Epidemiology?

A: The study and analysis of the distribution, patterns, and causes of health and illness conditions in…

Q: 1. "The Cell theory (All cells come from preexisting cells by cell division)" was originally…

A: Cell is the basic structural and functional unit of life. It was first discovered by Robert Hooke in…

Q: Darwin observed an orchid from Madagascar that had a nectar spur of about 30 cm in length. He…

A: Charles Darwin was a naturalist and biologist who has widely contributed to the field of…

Q: Point mutations in multiple tumor suppressor proteins have been linked to cancer. For example…

A: In transcription only a segment of DNA and only one of the strand is copied into RNA.

Q: Given the following question and choices: The initial pressure that initially stimulates…

A: Defecation is the process of removal f waste from the body. The rectal muscles are contracted and…

Q: The risk of Cancer increases as body mass increases. Determining right and wrong

A: Cancer: The uneven multiplication of cells inside the body which can, later on, evade the…

Q: Why do you think Linnaeus considered the flower as the most variable reliable basis for plant…

A: Introduction: Carl Linnaeus (1707-1778) was a Swedish botanist, zoologist, and physician who…

Q: Draw the stages of transcription are initiation, elongation, and termination. Be sure to include the…

A: Replication is the process by which DNA duplicates itself utilizing the enzyme DNA polymerase. The…

Q: Add Numbers 1-9 in order of when the statement is found in the entire malaria life cycle. #1 is…

Q: 16- A population's carrying capacity ____. a- increases as per capita growth rate (r) decreases…

A: The collection of all the individuals of same species in a particular area that interact with each…

Q: Which stage of meiosis involves the separation of homologous pairs of chromosomes? anaphase…

A: Meiosis is a type of cell division in which a diploid mother cell divides to form four haploid…

Q: Fishlake national forest in Utah contains a stand of 40,000 aspen trees, all of which came from a…

A: The term "clone" of aspens refers to a stand of aspens because every tree is a genetic duplicate of…

Q: 75. In a healthy person who is standing, which of the following best characterizes findings in the…

A: The ventilation and perfusion ratio is necessary for continuous oxygen supply and the removal of…

Q: The underlying structure of DNA is very simple, consisting of only four possible building blocks. a.…

A: DNA holds an individual's genetic information, as stated in the introduction. Phosphate, nitrogenous…

Q: 4. Explain why genetic code is three letters of nucleotides, not two or four letters.

A: In the cell,genetic information is stored in the form of DNA.The information is first transferred…

Q: A mermaid has the following genotype. AaBBCCDd. How many gametes with different genotypes will this…

A: Alleles are the alternative forms of a gene that are located on the same locas of a homologous…

Q: A fatty acid designated w-3 A) has three double bonds. B) is saturated. C) has a double bond three…

A: Introduction Fatty acids are the acids that are paired with glycerol in naturally occurring fats.…

Q: Among mammals, measurements of the rate of generation of autosomal recessive mutations have been…

A: Introduction: A mutation is a process that modifies a person's genome. The mutation may happen as a…

Q: In a world of advancing technologies and innovative health care, some individuals would rather rely…

A: Gene therapy is an experimental technique in which genes are used to treat or prevent diseases or…

Q: 8. If 45 colonies grew on the filter and 1 mL of a 105 dilution of the sample was filtered, how many…

A: Bacteria are the smallest living things which can seen under microscope. They are present in water ,…

Q: When a person receives a vaccination, it is considered passive and artificial passive and natural…

A: Introduction Vaccination is a process by which a person becomes protected against a particular…

Q: The mutant FMR-1 allele that causes fragile X syndrome is considered to be X-linked dominant with…

A: A genetic condition is fragile X syndrome. It causes a number of developmental issues, such as…

Q: A mutation was introduced to the original DNA and now you have following DNA sequence (the mutation…

A: A mutation is the change in the genetic material of an organism. A point mutation is the mutation…

Q: P₁0 ORF1 t₁ ORF2 ORF3 t₂ The diagram above illustrates an operon that is regulated by the RepR…

A: An operon is a group of genes and the regulatory elements that regulate the expression of those…

Q: 31 1. In guinea pig, fur color is determined by one gene, and fur length by another independently…

A: 1. Given: The black fur allele (B) , brown fur allele (b), short allele (S) and long fur (s) The…

Q: What cell component carries out translation?

A: Translation is synthesis of proteins in a specific amino acid sequence from mRNA. It begins with the…

Q: Among the techniques below, which method is used to study protein-protein interaction in vivo? Group…

A: Understanding the complex and unpredictable connections of proteins underlying a wide range of…

Q: explain how Klebsellaa causes pyogenic liver abcess. give details and mechanism

Q: what molecular complex serves as a recognition. factor for premature stop codons? exon-junction…

A: Codons are the combinations of three nucleotides and specify the amino acids during the process of…

Q: III. Problems A. The following must be present for photosynthesis to occur in angiosperms: as the…

A: Photosynthetic organisms transform light energy into chemical energy through a mechanism called…

Q: 12445 RD-Hom 4(167-277) A(194-277) A(97-138) A(97-167) 6 A(97-194) N595A 7890 A(619-723) HD 10…

A: A regulatory protein regulates the expression of a gene by binding with that gene through its DNA…

Q: Joan was born with 6 toes on each foot, a dominant trait called polydactyly. Two of her 5 siblings…

A: Given: Joan was born with 6 toes on each foot, a dominant trait called polydactyly. Two of her 5…

Q: Say, I have two offspring of my own and also three nephews in Michigan who I have never interacted…

A: The total of an organism's direct (personal) and indirect fitness is known as inclusive fitness. A…

Q: These are released by host cells in response to viral stimulation. Some act to prevent viral…

A: Introduction A virus is an infectious microorganism made up of a protein-coated segment of nucleic…

Q: 1.where we can we find the circle of willis in 10 mm pig embryo?what are the branches associated…

A: 1.The circle of Willis is mainly a vascular network.Basically,the circle of Willis is a part of the…

Q: f) Is the population in Hardy-Weinberg equilibrium at this locus? How do you know? Be specific!…

A: The effective population is generally lower than the actual population size. The effective…

Q: Why is erythropoietin a popular drug among athletes? Explain with the physiological mechanism. BIUG…

A: The primary hormone controlling red blood cell (RBC) formation is erythropoietin (EPO). Recombinant…

Concept explainers

Animal Behavior

Animal behavior can be defined as all the things that animals do. In response to a stimulus, an animal performs a certain fixed action pattern, or FAP, of behavior. This response occurs to make the animal more adaptable to change. So, behavior is generally a stimulus-oriented response. A behavior is an expression of the capabilities of the nervous system. A stimulus is determined by the environment, while the nervous system determines a response.

Question

S.Lack of Vitamin C (rich in fruits and vegetables) in the meals can lead to

scurvy in human. The reason why lions do not develop scurvy without

eating vegetable is that lions eat herbivore animals

Determining right and wrong

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Which of the following statements relating to survival needs is correct? nutrients contain chemical substances used for cell building and energy oxidative reactions require oxygen to release energy water acts as the fluid base for body excretions a and b a, b, and c
Which of the following statements is true? Multiple Choice Night eating syndrome is the same as sleepwalking. People with night eating syndrome have a huge appetite in the morning. People with night eating syndrome believe they can only fall asleep by having a full stomach. People with night eating syndrome do not experience any episodic food binges.
Which of the following foods should be consumed with the least amount * ?in those patients on warfarin Cabbage O Egg yolk O Liver Pork O Sunflower oil O
"Feeding cows grass is desirable because the grass helps maintain a more natural pH of the rumen, lessening the likelihood of ulcers and the need for antibiotics." True False
Individuals with an irrational fear of becoming overweight are known to have women anorexia nervosa These individuals tend to follow self-imposed individuals suffering from this disorder are and most purging muscle dysmorphia Individuals that follow cycles of binge-eating and then are known to have bulimia nervosa Individuals that tend to think their bodies are underdeveloped are known to have men starvation diets These individuals tend to be preoccupied with body-building activities and most individuals suffering from this disorder are
You are a volunteer with the Red Cross in a developing country and you find the following situation exists. Young children relying on un-enriched rice porridge show symptoms of fatigue/muscle weakness, apathy, confusion and poor memory. They constantly cry out to you "I can't, I can't" in their native language. What vitamin deficiency do they have? What is this deficiency called? How can it be prevented from recurring? pls help asap and explain. Thank you
Choice 1. Parathyroid Hormone (PTH) causes the kidneys to retain Ca2+. That means the kidneys keep calcium in the blood rather than let it go out into the urine. The target cells here are cells lining kidney tubules, which make urine. Calcitriol causes the small intestine to absorb more calcium from your food. (think about what that means- you don't always absorb all of the calcium from your food- if you have plenty, some of it stays in the digestive tract and goes out with the feces!) The target cells here are cells lining the small intestine, which are responsible for moving nutrients from the lumen of the intestine into the blood. Both hormones exert their effect by causing their target cells to insert more calcium transporters into their membranes. The water-soluble hormone uses cAMP as a second-messenger. Incidentally, PTH also causes cells of the kidneys to activate more calcitriol, and tells cells of the bone to release some stored calcium to the blood. a. Are these…
Fill in this chart for GI Disorder
Which of the following statements is FALSE? * Minerals are inorganic compounds Minerals are micronutrients Minerals are normally being absorbed in the large intestine Mineral content of feed ingredients may vary depending on the source Excess amount of minerals may cause toxicity to the animal
The benefits of eating fish for those who have previously suffered a heart attack include all of the following except: a. stabilizing heart rhythm b. reducing blood clotting O c. lowering LDL levels o d. lowering triglyceride levels
Regarding Leptin, which of the following is correct? Leptin is secreted proportionally to the fat mass Obese people have less leptin than Hean persons Leptin decreases the energy expenditure O None of the options is correct
Why does a high intake of alcohol lead to thiamin deficiency? Alcohol decreases the intestinal absorption of thiamin Alcohol leads to increased urinary excretion of thiamin Alcohol replaces food intake and decreases thiamin consumption O All options are correct